Synthetic Gene DataBase
 

Synthetic Gene 10


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID1010
GenBank AccessionAF324493
GenBank GI12831134
Gene Namevifhvif
Gene Length (bp)579579
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1HeLa cells
CDSatggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgaggattaacaca
tggaaaagattagtaaaacaccatatgtatatttcaaggaaagctaaggactggttttat
agacatcactatgaaagtactaatccaaaaataagttcagaagtacacatcccactaggg
gatgctaaattagtaataacaacatattggggtctgcatacaggagaaagagactggcat
ttgggtcagggagtctccatagaatggaggaaaaagagatatagcacacaagtagaccct
gacctagcagaccaactaattcatctgcactattttgattgtttttcagaatctgctata
agaaataccatattaggacgtatagttagtcctaggtgtgaatatcaagcaggacataac
aaggtaggatctctacagtacttggcactagcagcattaataaaaccaaaacagataaag
ccacctttgcctagtgttaggaaactgacagaggacagatggaacaagccccagaagacc
aagggccacagagggagccatacaatgaatggacactag
atggagaaccggtggcaggtgatgattgtgtggcaggtggaccgcatgcgcattaacacc
tggaagcgcctggtgaagcaccacatgtacattagccgcaaggccaaggactggttctac
cgccaccactacgagagcaccaaccccaagattagcagcgaggtgcacattcccctgggc
gacgccaagctggtgattaccacctactggggcctgcacaccggcgagcgcgactggcac
ctgggccagggcgtctccatagaatggaggaaaaagagatatagcacacaagtagaccct
gacctagcagaccaactaattcatctgcactattttgattgtttttcagaatctgctata
agaaataccatattaggacgtatagttagtcctaggtgtgaatatcaagcaggacataac
aaggtaggatctctacagtacttggcactagcagcattaataaaaccaaaacagataaag
ccacctttgcctagtgttaggaaactgacagaggacagatggaacaagccccagaagacc
aagggccacagagggagccatacaatgaatggacactag
5' End
3' End
NotesThe sequence was deduced from the wild-type sequence according to the method described.
Expression VectorpNL4-3pcDNA3.1 (Invitrogen)
Assay MethodsWestern blottingWestern blotting, nuclear run-on
ResultsUndetectableSignificant increase
Protein FunctionPromote viral infectivity
Recoding PurposeTo improve expression
Synthesized ByAuthors (Asymmetric PCR)
Recoding MethodThe N-terminal 84 of the 191 codons of the vif gene were fully optimized to conform with the
reported codon usage of highly expressed human genes (Kotsopoulou et al. 2000). A unique AgeI
restriction site at position 8 was created in the synthetic gene, preventing the arginine at
position from being fully-optimized.
Publication Author(s)Nguyen, K. L.; llano, M.; Akari, H.; Miyagi, E.; Poeschla, E. M.; Strebel, K.; Bour, S.
Corresponding AuthorStephan Bour
Corresponding AddressViral Biochemistry Section, Laboratory of Molecular Microbiology, National Institutes of Allergy Diseases, Bethesda, MD 20892, USA.
Publication Year2004
Publication TitleCodon optimization of the HIV-1 vpu and vif genes stabilizes their mRNA and allows for highly efficient Rev-independent expression
AbstractTwo HIV-1 accessory proteins, Vpu and Vif, are notoriously difficult to express autonomously in the absence of the viral Tat and Rev proteins. We examined whether the codon bias observed in the vpu and vif genes relative to highly expressed human genes contributes to the Rev dependence and low expression level outside the context of the viral genome. The entire vpu gene as well as the 5' half of the vif gene were codon optimized and the resulting open reading frames (ORFs) (vphu and hvif, respectively) were cloned in autonomous expression vectors under the transcriptional control of the CMV promoter. Codon optimization efficiently removed the expression block observed in the native genes and allowed high levels of Rev- and Tat-independent expression of Vpu and Vif. Most of the higher protein levels detected are accounted for by enhanced steady-state levels of the mRNA encoding the optimized species. Nuclear run-on experiments show for the first time that codon optimization has no effect on the rate of transcriptional initiation or elongation of the vphu mRNA. Instead, optimization of the vpu gene was found to stabilize the vphu mRNA in the nucleus and enhance its export to the cytoplasm. This was achieved by allowing the optimized mRNA to use a new CRM I-independent nuclear export pathway. This work provides a better understanding of the molecular mechanisms underlying the process of codon optimization and introduces novel tools to study the biological functions of the Vpu and Vif proteins independently of other viral proteins.
JournalVirology. 319(2): 163-75.
SummaryTwo small HIV-1 accessory genes, vpu and vif, were optimized for codon usage towards the pattern observed in highly expressed human genes. Codon optimization dramatically enhanced the expression of both genes. Interestingly, this enhancement was due to the increase of mRNA stability after codon optimization.
CommentsThe env and AgeI, AfeI sites cannot be found in the recoded gene as described in the in vphu
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=517
PubMed ID15015498
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site