Synthetic Gene DataBase
 

Synthetic Gene 100


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID87100
GenBank AccessionU52958
GenBank GI1381560
Gene NameTP2TP2
Gene Length (bp)345345
SpeciesRattus norvegicusEscherichia coli
StrainsNot mentionedBL21 (DE3) pLysS
CDSatggacaccaagatgcagagccttcccaccactcatccccacccgcacagctcctctcgg
cctcaaagtcacaccaataaccagtgtgcctgcagccaccactgccggagctgcagccaa
gcaggccacccgagctccagttccagccccagccctggcccgccgacgaagcaccccaaa
acacccatgcactctcgttactcaccttcaagacccagccaccgcggcagctgccccaag
aacaggaagaccttggaagggaaagtgagcaagagaaaggcggtcaggaggcggaagcgg
actcacagagctaagaggcgtagctcaggacgaagatacaagtga
atggacaccaagatgcagagccttccgaccactcatccgcacccgcacagctcctctcgg
cctcaaagtcacaccaataaccagtgtgcctgcagccaccactgccggagctgcagccaa
gcaggccacccgagctccagttccagccccagccctggcccgccgacgaagcaccccaaa
acacccatgcactctcgttactcaccttcacgtcccagccaccgcggcagctgcccgaaa
aaccgtaaaaccctggaaggcaaagtgagcaaacgtaaagcggtgcgtcgccgtaaacgc
acccaccgtgcgaaacgtcgcagctctggccgtcgctataaatga
5' End
3' End
NotesThe recoded gene has not been put into the GenBank database, so no accession number could be provided.
Expression VectorpTrc 99ApTP2-8
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe wild type gene gave a very low expression rate when cloned into the pTrc 99A expression vector.The recoded gene showed significant risse in amount of expression compared to the natural gene; at least 6 times as much protein was produced.
Protein FunctionReplace somatic and testis specific histones in the spermatid chromatin during spermiogenesis
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method was not explained in this paper, although the recoding took place almost
exclusively in the C-terminal end of the gene. The authors state that the construction "has been
described by us recently" in their 1996 paper titled "Cloning of cDNA encoding rat spermatidal
protein TP2 and expression in Escherichia coli.
Publication Author(s)Meetei, A. R.; Rao, M. R.
Corresponding AuthorA. Meetei
Corresponding AddressDepartment of Biochemistry, Indian Institute of Science, Bangalore-, 560 012, India.
Publication Year1998
Publication TitleHyperexpression of rat spermatidal protein TP2 in Escherichia coli by codon optimization and engineering the vector-encoded 5' UTR
AbstractWe have recently reported the cDNA cloning of rat spermatidal protein TP2 and its expression in Escherichia coli using pTrc 99A as the expression vector. However, the expression level was very low. We have now improved the expression of TP2 over fivefold by (1) optimizing the codons for lysine, arginine, proline, leucine, glycine, valine, threonine, alanine, and tyrosine and (2) by engineering the vector-encoded 5' UTR. The expressed protein was in the soluble phase and could be purified to homogeneity by successive chromatography on Zinc-NTA-agarose affinity matrix and heparin agarose. Serendipitously, we have also observed a concomitant hyperinduction of vector encoded beta-lactamase gene along with TP2 in the E. coli BL21 (DE3) cells.
JournalProtein Expr Purif. 13(2): 184-90.
SummaryThe goal of this experiment was to optimize rat spermatidal protein TP2 for expression in E. coli. The TP2 gene and the optimized TP2 gene were cloned into the pTrc 99A expression vector, and were expressed in BL21 (DE3) cells. The recoded gene gave a significantly higher expression rate than the natural gene; up to 6 times as much TP2 protein was produced.
CommentsAn e-mail could not be found for the corresponding author.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=676#676
PubMed ID9675061
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site