Synthetic Gene DataBase
 

Synthetic Gene 101


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID88101
GenBank AccessionAF461757
GenBank GI56718466
Gene NameVP6VP6
Gene Length (bp)11941194
SpeciesRotavirus AEscherichia coli
StrainsCJNBL21 (DE3)
CDSatggaagttttatattcattgtcaaaaactcttaaagatgctagggaccgtattgttgaa
ggtacattatattctaatgttagcgatctcattcaacaattcaatcaaatgatagtaact
atgaatggaaatgactttcaaactggaggaattggtaatttgcctattagaaactggact
ttcgattttggtctattaggtacaacacttttaaatttagatgctaattacgttgagaat
gctagaactacaattgaatattttattgactttattgataatgtatgtatggatgaaatg
gcaagagagtctcaaagaaatggagtagctccacaatctgaagcgttaaggaagttatca
ggtattaaattcaagagaataaattttgataattcatctgaatatatagaaaattggaac
ttacaaaataagaggcagcgtaccggatttgttttccataaacctaatatatttccatac
tcagcttcatttactttaaatagatctcaaccaatgcatgataatctgatgggaactatg
tggcttaatgctggatcagaaattcaggtagccggatttgattattcatgcgctataaat
gcaccagcaaacatacagcaatttgaacatattgtccagcttaggcgtgcgctaactaca
gctactataactttattacctgatgcagaaagattcagttttccaagagttattaattca
gctgatggcgcgactacatggttctttaatccagtcattttaagaccaaataatgttgaa
gtagaatttttgttgaatggacaaattattaatacatatcaagctagatttggcactatt
attgcaagaaattttgatactattcggttgtcattccagttaatgcgcccaccaaatatg
acgccagttgttaatgcactgtttccgcaagcacaaccttttcaacatcatgcaacagtt
ggacttacattacgtattgaatctgcagtttgtgaatcagtgcttgcggatgctaatgag
actctactggcgaatgtgaccgcagtacgtcaagagtatgctataccagttggtccggta
tttccaccaggcatgaattggactgaattaattactaattattcaccatctagagaagat
aatttacaacgtgtttttacagtagcttctattagaagcatgttgattaagtga
atggaagtgctgtatagcttatctaaaaccttgaaggatgcgcgcgaccgtattgttgag
ggcacgctgtacagtaacgtctccgatcttatccagcaatttaatcagatgatagtaact
atgaacggtaatgacttccaaacagggggaattggcaacctcccgatccggaattggacc
tttgatttcggtctgctgggcacgaccctactgaacttagatgccaattatgtggaaaac
gcacgaactaccattgaatactttatcgacttcattgataatgtttgcatggatgagatg
gctcgcgaatcgcagcgtaacggtgtcgcgccacagtcagaagccttgagaaaactgagc
gggatcaaatttaaacgcattaattttgacaactctagtgagtatatcgaaaattggaac
cttcaaaacaagcgtcagcgcacgggcttcgtgtttcataaacctaatattttcccgtac
agcgcatcctttacactgaaccgttcgcagcccatgcacgataatctcatgggtaccatg
tggctgaacgcgggatcagaaatacaggtagctggcttcgactatagctgtgccattaat
gcgccggcaaacatccagcagtttgagcatattgttcaactgaggcgcgccttaactacc
gcgacgatcaccttgctaccagatgctgaacgtttttctttcccgcgggtgattaatagt
gcagatggtgcgacaacgtggtttttcaaccctgtcatcctgcgcccgaataacgtggaa
gttgagtttcttctcaatggccagattatcaacacctatcaggcccgtttcgggactatt
atcgcgcgcaactttgacaccattcgtctgtcctttcaattaatgcgacccccgaatatg
acgccagtagtgaacgctctgttcccgcaggcacagccttttcaacaccatgccaccgtc
ggtttgacactgcgcatagaatcggcggtttgcgaaagcgtgctggccgatgcaaatgag
actcttctggcgaacgttaccgctgtgcgtcaggaatacgcgattccggtcggcccggta
ttcccaccgggtatgaattggacggaactgatcaccaactattcacccagccgcgaggat
aatttacagcgtgtgtttacggttgcctctattcggagtatgctgatcaaatga
5' End
3' End
Notes
Expression VectorpMAL-c2XpMAL-c2X/CJNOptVP6-His6
Assay MethodsWestern BlotWestern blot
ResultsThe natural gene was expressed poorly when cloned into the pMAL-c2X expression vector. After purification, mice were vaccinated with the product, and a large number of them contracted the virus when exposed to it.The recoded gene was expressed in a much greater amount than the natural gene; when rats were immunized with purified product, 87-99% of them were immune to rotavirus A.
Protein FunctionSole structural component of middle layer of rotavirus capsid
Recoding PurposeTo improve expression
Synthesized ByChoi et all
Recoding MethodThe recoded gene was synthesized via a computer program available from Entelechon GmbH using an E.
coli codon usage table provided by Dr. Yasukazu Nakamura.
Publication Author(s)Choi, A. H.; Basu, M.; McNeal, M. M.; Bean, J. A.; Clements, J. D.; Ward, R. L.
Corresponding AuthorAnthony H. Choi
Corresponding AddressDivision of Infectious Diseases, Cincinnati Children's Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229-3039, USA. anthony.choi@cchmc.org
Publication Year2004
Publication TitleIntranasal administration of an Escherichia coli-expressed codon-optimized rotavirus VP6 protein induces protection in mice
AbstractWe are developing rotavirus vaccines based on the VP6 protein of the human G1P [J. Virol. 73 (1999) 7574] CJN strain of rotavirus. One prototype candidate consisting of MBP::VP6::His6, a chimeric protein of maltose-binding protein, VP6 and hexahistidine, was expressed mainly as truncated polypeptides in Escherichia coli BL21(DE3) cells. A possible reason for this extensive truncation is the high frequencies of rare bacterial codons within the rotavirus VP6 gene. Expression of truncated recombinant VP6 was found to be reduced, and expression of complete VP6 protein was simultaneously increased, when the protein was expressed in Rosetta(DE3)pLacI E. coli cells that contain increased amounts of transfer RNAs for a selection of rare codons. The same observation was made when a synthetic codon-optimized CJN-VP6 gene was expressed in E. coli BL21 or Rosetta cells. To increase protein recovery, recombinant E. coli cells were treated with 8M urea. Denatured, full-length MBP::VP6::His6 protein was then purified and used for intranasal vaccination of BALB/c mice (2 doses administered with E. coli heat-labile toxin LT(R192G) as adjuvant). Following oral challenge with the G3P [J. Virol. 76 (2002) 560] EDIM strain of murine rotavirus, protection levels against fecal rotavirus shedding were comparable (P>0.05) between groups of mice immunized with denatured codon-optimized or native (not codon-optimized) immunogen with values ranging from 87 to 99%. These protection levels were also comparable to those found after immunization with non-denatured CJN VP6. Thus, expression of complete rotavirus VP6 protein was greatly enhanced by codon optimization, and the protection elicited was not affected by denaturation of recombinant VP6.
JournalProtein Expr Purif. 38(2): 205-16.
SummaryThe goal of this experiment was to develop a more effective rotavirus A vaccine through gene optimization and expression of the VP6 protein, which is the sole comprising protein of the middle layer of rotavirus A capsid. After optimization, the gene was cloned into pMAL-c2X expression vector and inserted into BL21 (DE3) strain of E. coli. The recoded gene gave a high rate of expression, allowing for an effective immunization to be created.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=679#679
PubMed ID15555936
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site