Synthetic Gene DataBase
 

Synthetic Gene 102


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID89102
GenBank AccessionM29644
GenBank GI183119
Gene NamehIGF-1rthIGF-1
Gene Length (bp)393393
SpeciesHomo sapiensOryza sativa, Nicotiana tabacum
StrainsLeaves
CDSatgcacaccatgtcctcctcgcatctcttctacctggcgctgtgcctgctcaccttcacc
agctctgccacggctggaccggagacgctctgcggggctgagctggtggatgctcttcag
ttcgtgtgtggagacaggggcttttatttcaacaagcccacagggtatggctccagcagt
cggagggcgcctcagacaggtatcgtggatgagtgctgcttccggagctgtgatctaagg
aggctggagatgtattgcgcacccctcaagcctgccaagtcagctcgctctgtccgtgcc
cagcgccacaccgacatgcccaagacccagaaggaagtacatttgaagaacgcaagtaga
gggagtgcaggaaacaagaactacaggatgtag
5' End
3' End
NotesAccession number, GI, and CDS not provided for natural gene, but gene for protein is provided instead from Genbank. No accession number, GI, or CDS provided for recoded gene, sent email to corresponding author for complete CDS for recoded gene on 1-10-06, but article claims that amino acid amount is the same, leading to the same length.
Expression VectorpKHG4pKHG4
Assay MethodsWestern Blot, ELISAWestern Blot, ELISA
ResultsLittle significant amount of proteinSignificant increase (3 fold higher, 371 ng/mg of protein in rice and 241 ng/mg in tobacco)
Protein FunctionStimulates proliferation and differentiation of cells
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons in natural gene were changed/modified based on the codon usage patterns of rice and tobacco
plants, this in turn increased G+C content.
Publication Author(s)Panahi, M.; Alli, Z.; Cheng, X.; Belbaraka, L.; Belgoudi, J.; Sardana, R.; Phipps, J.; Altosaar, I.
Corresponding AuthorIllimar Altosaar
Corresponding AddressDepartment of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, 451 Smyth Road, Ottawa, Ontario, K1H 8M5, Canada.
Publication Year2004
Publication TitleRecombinant protein expression plasmids optimized for industrial E. coli fermentation and plant systems produce biologically active human insulin-like growth factor-1 in transgenic rice and tobacco plants
AbstractHuman insulin-like growth factor-1 (hIGF-1) is a growth factor with clinical significance in medicine. The therapeutic potential of recombinant hIGF-1 (rthIGF-1) stems from the fact that hIGF-1 resembles insulin in many aspects of physiology. The expression of hIGF-1 in transgenic tobacco and rice plants using different expression cassettes is reported here. In the present study, two coding sequences were tested, one with the original human sequence, but partially optimized for expression in E. coli and the other with a plant-codon-optimized sequence that was expected to give a higher level of expression in plant systems. Three different hIGF-1 recombinant expression constructs were generated. All expression constructs utilized the maize ubiquitin 1 promoter with or without a signal sequence. Analyses conducted using a hIGF-1 specific ELISA kit showed all transgenic plants produced hIGF-1 and the accumulated hIGF-1 increased from the E. coli codon bias to higher levels when the hIGF-1 coding sequence was codon-optimized to match that of the maize zeamatin protein--the most transcribed gene in maize endosperm suspension cells. Further analyses that compared the functionality of the bacterial signal peptide Lam B in plants showed that this leader peptide led to lower expression levels when compared to transgenic plants that did not contain this sequence. This indicated that this expression construct was functional without removal of the bacterial signal sequence. The maize ubiquitin 1 promoter was found to be more active in rice plants than tobacco plants indicating that in this case, there was a class preference that was biased towards a monocot host. Biological analyses conducted using protein extracts from transgenic plants showed that the rthIGF-1 was effective in stimulating the in vitro growth and proliferation of human SH-SY5Y neuroblastoma cells. This indicated that the plant-produced rthIGF-1 was stable and biologically active. As some plants have been reported to express an endogenous insulin-like protein, we also looked for any effect of the human growth factor in transgenic plants, but no developmental or morphological differences with wild type tobacco or rice plants were detected. Since insulin and hIGF-1 share some overlapping roles, hIGF-1 may become a substitute therapeutic agent in subjects with certain defects in their insulin receptor signaling. Hence, if the full beneficial potential of rthIGF-1 is achieved, it is expected that in the future the demand will likely increase significantly.
JournalTransgenic Res. 13(3): 245-59.
SummaryRice (Oryza sativa) and tobacco (Nicotiana tabacum) were transformed with a recoded version, rthIGF-1, of the Human insulin-like growth factor gene (hIGF-1) in order to increase the expression protein. The recoded gene had its codons replaced and/or modified in order to conform to the patterns of highly expressed genes in rice and tobacco. The recoded gene, rthIGF-1, had a much higher yield of protein than the natural gene. Overall, the recoding was a success in creating a higher yield of protein than the natural gene.
CommentsAccession number, GI, and CDS not provided for natural gene, but gene for protein is provided instead from Genbank. No accession number, GI, or CDS provided for recoded gene, sent email to corresponding author for complete CDS for recoded gene on 1-10-06, but article claims that amino acid amount is the same, leading to the same length.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=551
PubMed ID15359602
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site