Synthetic Gene DataBase
 

Synthetic Gene 103


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID90103
GenBank AccessionU39362
GenBank GI9409797
Gene Namegp120R2 (env)co gp120R2 (env)
Gene Length (bp)25621563
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
StrainsType 1293T cells
CDSatgagagtgaaggagatcaggaagaattggcagcacttgagagggggcatcttgctcctt
gggatgttgatgatctgtagtgctgcaaaagaaaaaacgtgggtcacaatctattatggg
gtacctgtgtggagagaagcaaccaccactctattttgtgcatcagatgctaaagcctat
gatacagaggtacataatgtttgggccacacatgcctgtgtacccacagaccccaaccca
caagaagtagtattgggaaatgtgacagaaaattttaacatgtggaaaaataacatggta
gatcagatgcatgaggatataatcagtttatgggatgaaagcctaaagccatgtgtaaaa
ttaaccccactctgtgttactttaaattgcactaatttgaatatcactaagaatactact
aatcccactagtagcagctggggaatgatggagaaaggagaaataaaaaattgctctttc
tatatcaccacaagcataagaaataaggtaaagaaagaatatgcactttttaatagactt
gatgtagtaccaatagaaaatactaataatactaagtataggttaataagttgtaacacc
tcagtcattacacaggcctgtccaaaggtatcctttcagccaattcccatacattattgt
gtcccggctgggtttgcgatgctaaagtgtaacaataagacattcaatggatcaggacca
tgcacaaatgtcagcacagtacaatgtacacatggaattaggccagtggtgtcaactcaa
ctgctgttaaatggcagtctagcagaagaagacatagtaattagatctgaaaatttcaca
gacaatgctaaaaccataatagtacagctaaatgaatctgtagtaattaattgtacaaga
cccaacaacaatacaagaagaaggttatctataggaccagggagagcattttatgcaaga
agaaacataataggagatataagacaagcacattgtaacattagtagagcaaaatggaat
aacactttacaacagatagttataaaattaagagaaaaatttaggaataaaacaatagcc
tttaatcaatcctcaggaggggacccagaaattgtaatgcacagttttaattgtggaggg
gaatttttctactgtaatacagcacaactgtttaatagtacttggaatgttactggaggg
acaaatggcactgaaggaaatgacataatcacactccaatgcagaataaaacaaattata
aatatgtggcagaaagtaggaaaagcaatgtatgcccctcccatcacaggacaaattaga
tgttcatcaaatattacagggctgctactaacaagagatggaggtaatagtactgagact
gagactgagatcttcagacctggaggaggagatatgagggacaattggagaagtgaatta
tataaatataaagtagtaagaattgaaccaataggagtagcacccaccagggcaaagaga
agaacagtgcaaagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttg
ggagcagcaggaagcactatgggcgcagcgtcagtgacgctgacggtacaggccaggcta
ttattgtctggtatagtgcagcagcagaacaatctgctgagggctattgaggcgcaacag
catatgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctctg
gaaagatacctaagggatcaacagctcatgggaatttggggttgctctggaaaactcatt
tgcaccacttctgtgccttggaatgttagttggagtaataaatctgtggatgatatttgg
aataacatgacctggatggagtgggaaagagaaattgacaattacacagactatatatat
gacttacttgaaaaatcgcaaacccaacaagaaaagaatgaaaaagaattattggaattg
gataaatgggcaagtttgtggaattggtttgacataacaaactggctgtggtatataaga
ttattcataatgatagtaggaggcttgataggtttaagaatagtttttgctgtactttct
atagtaaatagagttaggcagggatattcaccattatcgtttcagaccctcctcccagcc
tcgaggggacccgacaggcccgaaggaacagaagaagaaggtggagagagagacagagac
agatccggtccattagtgaacggattcttggcacttttctgggtcgatttgaggaacctg
tgcctcttcctctaccacctcttgagaaacttactcttgattgtaacgaggattgtggaa
cttctgggacgcagggggtgggaagccctcaaatattggtggaatctcctgcaatattgg
agccaggaactaaagaatagtgctgttagcttgctcaacgccacagccatagcagtagct
gaggggacagatagggttataaaaatagtacaaagagcttgtagagctattcgcaacata
cctacaagaatcagacagggcttggaaagggctttgctataa
atgcgcgtgaagggcatccgccgcaactaccagcactggtggggctggggcaccatgctg
ctgggcctgctgatgatctgcagcgccaccgagaagctgtgggtgaccgtgtactacggc
gtgcccgtgtggaaggaggccaccaccaccctgttctgcgccagcgacgccaaggcctac
gacaccgaggcccacaacgtgtgggccacccacgcctgcgtgcccaccgaccccaacccc
caggaggtggagctggtgaacgtgaccgagaacttcaacatgtggaagaacaacatggtg
gagcagatgcacgaggacatcatcagcctgtgggaccagagcctgaagccctgcgtgaag
ctgacccccctgtgcgtgaccctgaactgcaccgacctgcgcaacaccaccaacaccaac
aacagcaccgacaacaacaacagcaacagcgagggcaccatcaagggcggcgagatgaag
aactgcagcttcaacatcgccacctccatcggcgacaagatgcagaagaagtacgccctg
ctgtacaagctggacatcgagcccatcgacaacgacaacaccagctaccgcctgatcagc
tgcaacaccagcgtgatcacccaggcctgccccaagatcagcttcgagcccatccccatc
cactactgcgcccccgccggcttcgccatcctgaagtgcaacgacaagaagttcagcggc
aagggcagctgcaagaacgtgagcaccgtgcagtgcacccacggcatccgccccgtggtg
agcacccagctgctgctgaacggcagcctggccgaggaggaggtggtgatccgcagcgag
aacttcaccaacaacgccaagaccatcatcgtgcagctgcgcgagcccgtgaagatcaac
tgcagccgccccaacaacaacacccgcaagagcatccccatgggccccggccgcgccttc
tacaccaccggccagatcatcggcgacatccgccaggcccactgcaacatcagcaagacc
aactggaccaacgccctgaagcaggtggtggagaagctgggcgagcagttcaacaagacc
aagatcgtgttcaccaacagcagcggcggcgaccccgagatcgtgacccacagcttcaac
tgcgccggcgagttcttctactgcaacaccacccagctgttcgacagcatctggaacagc
gagaacggcacctggaacatcacccgcggcctgaacaacaccggccgcaacgacaccatc
accctgccctgccgcatcaagcagatcatcaaccgctggcaggaagtgggcaaggccatg
tacgcccctcccatcaagggcaacatcagctgcagcagcaacatcaccggcctgctgctg
acccgcgacggcggcaaggacgacaacagccgcgacggcaacgagaccttccgccccggc
ggcggcgacatgcgcgacaactggcgcagcgagctgtacaagtacaaggtggtgaagatc
gagcccctgggcgtggcccccaccaaggccaagcgacgcgtggtgcagcgcgaggagcgc
taa
5' End
3' End
NotesGenBank Accession No. was not provided by the authors. Thus U39362 is used for a record.A hard copy of the sequence is provided by Dr. Ted M. Ross.
Expression VectorpTR600pTR600
Assay MethodsELISA, t testELISA, t test
ResultsUndetectableSignificant increase.
Protein Functionenvelope glycoprotein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodused codons for enhanced expression in mammalian cells
Publication Author(s)Young, K. R.; Teal, B. E.; Brooks, Y.; Green, T. D.; Bower, J. F.; Ross, T. M.
Corresponding AuthorDr, Ted M. Ross
Corresponding AddressDepartment of Medicine, Division of Infectious Diseases, University of Pittsburgh, School of Medicine, Pittsburgh, Pennsylvania 15261, USA.
Publication Year2004
Publication TitleUnique V3 loop sequence derived from the R2 strain of HIV-type 1 elicits broad neutralizing antibodies
AbstractDNA vaccines expressing the envelope (Env) of the human immunodeficiency virus type 1 (HIV-1) have been relatively ineffective at generating high-titer, long-lasting, neutralizing antibodies. In this study, DNA vaccines were constructed to express the gp120 subunit of Env from the isolate HIV-1(R2) using both wild-type and codon-optimized gene sequences. Three copies of the murine C3d were added to the carboxyl terminus to enhance the immunogenicity of the expressed fusion protein. Mice (BALB/c) vaccinated with DNA plasmid expressing the gp120(R2) using codon-optimized Env sequences elicited high-titer anti-Env antibodies regardless of conjugation to C3d. In contrast, only mice vaccinated with DNA using wild-type gp120(R2) sequences fused to mC3d(3), had detectable anti-Env antibodies. Interestingly, mice vaccinated with DNA expressing gp120(R2) from codon-optimized sequences elicited antibodies that neutralized both homologous and heterologous HIV-1 isolates. To determine if the unique sequence found in the crown of the V3 loop of the Env(R2) was responsible for the elicitation of the cross-clade neutralizing antibodies, the codons encoding for the Pro-Met (amino acids 313-314) were introduced into the sequences encoding the gp120(ADA) (R5) or gp120(89.6) (R5X4). Mice vaccinated with gp120(ADA)-mC3d(3)-DNA with the Pro-Met mutation had antibodies that neutralized HIV-1 infection, but not the gp120(89.6)-mC3d(3)-DNA. Therefore, the use of the unique sequences in the Env(R2) introduced into an R5 tropic envelope, in conjunction with C3d fusion, was effective at broadening the number of viruses that could be neutralized. However, the introduction of this same sequence into an R5X4-tropic envelope was ineffective in eliciting improved cross-clade neutralizing antibodies.
JournalAIDS Res Hum Retroviruses. 20(11): 1259-68.
SummaryThe goal of this study is to analyze the effectiveness of the unique V3 sequence from EnvR2 introduction into the env genes from two prototype R5 strains to determine if the Pro-Met mutation would confer increased neutralization capacity following DNA vaccination. Wild type and synthetic codon-optimized sequences alone or in conjugation with mC3d3 were used. The synthetic gp120R2 gene was constructed using codons for enhanced expression in mammalian cells. Codon-optimized gp120R2 elicited high titer anti-Env antibodies regardless of conjugation to C3d. Wild type gp120R2 expression was undetectable unless it was fused to mC3d3. The codons encoding for the Pro-met were introduced into the sequences encoding the gp120ADA (R5) or gp12089.6 (R5X4). The results showed that only mice vaccinated with gp120ADA - mC3d3 – DNA with the Pro-Met mutation had antibodies that neutralized HIV-1 infection, but not with gp12089.6 - mC3d3 – DNA.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=623
PubMed ID15588348
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site