Synthetic Gene DataBase
 

Synthetic Gene 104


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID91104
GenBank Accession
GenBank GI
Gene NametetRtetR (mammalianized)
Gene Length (bp)618618
SpeciesE. coliChinese hamster
Strains(mutant)ovary cells
CDStctagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcgga
atcgaaggtttaacaacccgtaaactcgcccagaagcttggtgtagagcagcctacactg
tattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagat
aggcaccatactcacttttgccctttaaaaggggaaagctggcaagattttttacgcaat
aacgctaaaagttttagatgtgctttactaagtcatcgcaatggagcaaaagtacattca
gatacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgc
caacaaggtttttcactagagaacgcgttatatgcactcagcgctgtggggcattttact
ttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacct
actactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggt
gcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaactt
aaatgtgaaagtgggtcc
tctagactgcataagagcaaggtgatcaacagcgccctggagctgctgaacgaggtgggc
atcgagggcctgaccaccagaaagctggcccagaagctgggcgtggagcagcctaccctg
tactggcatgtgaagaacaagagggctctgctggacgccccggccatcgagatgctggac
aggcaccacacccacttctgccctttaaaaggcgagagctggcaggacttcctgcgcaac
aacgccaagagcttcagatgtgccctgctgagccaccgcaacggcgccaaggtgcactcc
gacaccaggcctaccgagaagcagtatgagaccctggagaaccagctggccttcctgtgc
cagcagggcttctccctggagaacgcgttgtacgccctgagcgccgtgggccacttcacc
ctgggctgcgtgctggaggaccaggagcaccaggtggccaaggaggagagggagacccct
accactgacagcatgcccccactgctgagacaggccatcgagctgttcgaccaccagggc
gccgagccagccttcctgttcggcctggagctgatcatctgcggcctggagaagcagctg
aagtgtgagagcggctcc
5' End
3' End
NotesWild-type coding sequence obtained using OCR software. pTetlessGREEN is identical to pTetGREEN but lacks the tetR gene (rtTA expression cassette).Recoded gene coding sequence obtained using OCR software. CUTG website http://www.kazusa.or.jp/codon/
Expression VectorpTetGREEN (contains G418 resistance cassette and GFP tag)
Assay Methodsmicroscopy, rtTA dependent β-gal reportermicroscopy, rtTA dependent β-gal reporter
ResultsFew fluorescent green cells observed, after G418 selection, no fluorescent cells were seen. When pTetlessGREEN was used, fluorescent cells were observed, indicating that tetR expression was inhibiting downstream GFP expression.pmTetGREEN produced fluorescent cells. All analyzed fluorescent colonies expressed rtTA and expression was 88% increased from that of the wild-type tetR gene.
Protein FunctionThe production of the rtTA (reverse tet transactivator) transcription factor is induced by doxycyclin. The active protein can induce expression from promoters containing tetO.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Method156 point mutations (referenced CUTG)
Publication Author(s)Wells, K. D.; Foster, J. A.; Moore, K.; Pursel, V. G.; Wall, R. J.
Corresponding AuthorRobert J. Wall
Corresponding AddressGene Evaluation and Mapping Laboratory, LPSI, BARC, Beltsville, MD 20705, USA.
Publication Year1999
Publication TitleCodon optimization, genetic insulation, and an rtTA reporter improve performance of the tetracycline switch
AbstractThe objective of this work was to further develop a tetracycline repressor (TetR) protein system that allows control of transgene expression. First, to circumvent the need for a binary approach, a single plasmid design was constructed and tested in tissue culture. To indirectly assay integrations that express the synthetic transcription factor (rtTA), a bicistronic gene was built which included an internal ribosome entry site (IRES) and a green fluorescent protein coding region (GFP) on the same expression cassette as the coding region of rtTA (pTetGREEN). This construct did not produce fluorescent colonies when stably integrated and provided minimal expression of GFP in the face of adequate expression of rtTA. The coding region for TetR was then altered by introducing 156 silent point mutations to simulate mammalian genes. Replacement of wild-type TetR gene (tetR) in pTetGREEN with 'mammalianized' tetR provided GFP expression. Adjustment of codon usage in the tetR region of rtTA nearly doubled the expression level of functional rtTA. To increase the number of rtTA expressing lines, the chicken egg-white lysozyme matrix attachment region (MAR) was introduced into the single plasmid design just upstream of the tetracycline operators (tetO). Inclusion of the MAR doubled the number of colonies that expressed rtTA (44% vs 88%). With the modifications described here, the number of lines that express rtTA and provide induction from a single plasmid design can be increased by the inclusion of a MAR and the level of rtTA expression can be further increased by adjusting the base composition of the TetR coding region. The MAR also insulates the inducible gene from the promoter driving rtTA.
JournalTransgenic Res. 8(5): 371-81.
SummaryThe authors wanted to improve a method by which transgene expression in both mammalian cells an entire mammalian organism can be induced. The mutant E. coli tetracycline repressor (tetR) system was used. The tetR gene can be induced by doxycycline to produce the transcription factor rtTA. rtTA can activate the expression of genes attached to promoters that contain a tet operator. The tetR gene was inserted into a plasmid constructed by the authors. Three plasmids of interest were constructed. All three plasmids had G418 resistance cassettes, CMV promoter in front of the tetR gene, and IRES/GFP tag immediately downstream of the tetR gene. The first plasmid contained the wild-type tetR gene, the second a mammalianized tetR. The third plasmid lacked the tetR region, leaving IRES/GFP directly downstream of CMV. All plasmids were expressed within Chinese hamster ovary cells. The authors found that the plasmid lacking tetR produced more fluorescent cells and colonies than the plasmid containing the wild-type tetR gene. In order for downstream gene expression to be inducible; however, the tetR cassette must be present and functional. The authors attempted to improve the expression of the gene by aggressively recoding the 156 base pairs to represent the coding regions of abundantly expressed mammalian genes (referenced CUTG). The results from the plasmid containing the recoded gene were better than the wild-types. Green fluorescent colonies were visualized and all fluorescent cells expressed rtTA. The levels of the rtTA gene product were almost twice that of the wild-type gene’s.
CommentsRecoding method is NOT emphasized in this paper. Contact corresponding author for more details.
Discussion
PubMed ID10669945
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site