Synthetic Gene DataBase
 

Synthetic Gene 106


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID92106
GenBank AccessionM14119AY191839
GenBank GI33302627763823
Gene NameL1L1st
Gene Length (bp)15061443
SpeciesHuman papillomavirus (HPV)Solanum tuberosum
StrainsType 11Tubers
CDSatgtggcggcctagcgacagcacagtatatgtgcctcctcccaaccctgtatccaaggtt
gttgccacggatgcgtatgttaaacgcaccaacatattttatcatgccagcagttctaga
ctccttgctgtgggacatccatattactctatcaaaaaagttaacaaaacagttgtacca
aaggtgtctggatatcaatatagagtgtttaaggtagtgttgccagatcctaacaagttt
gcattacctgattcatccctgtttgaccccactacacagcgtttagtatgggcgtgcaca
gggttggaggtaggcaggggtcaacctttaggcgttggtgttagtgggcatccattgcta
aacaaatatgatgatgtagaaaatagtggtgggtatggtggtaatcctggtcaggataat
agggttaatgtaggtatggattataaacaaacccagctatgtatggtgggctgtgctcca
ccgttaggtgaacattggggtaagggtacacaatgttcaaatacctctgtacaaaatggt
gactgccccccgttggaacttattaccagtgttatacaggatggggacatggttgataca
ggctttggtgctatgaattttgcagacttacaaaccaataaatcggatgttccccttgat
atttgtggaactgtctgcaaatatcctgattatttgcaaatggctgcagacccttatggt
gataggttgtttttttatttgcgaaaggaacaaatgtttgctagacacttttttaatagg
gccggtactgtgggggaacctgtgcctgatgacctgttggtaaaagggggtaataacaga
tcatctgtagctagtagtatttatgtacatacacctagtggctcattggtgtcttcagag
gctcaattatttaataaaccatattggcttcaaaaggctcagggacataacaatggtatt
tgctggggaaaccacttgtttgttactgtggtagataccacacgcagtacaaatatgaca
ctatgtgcatctgtgtctaaatctgctacatacactaattcagattataaggaatacatg
cgccatgtggaggagtttgatttacagtttatttttcaattgtgtagcattacattatct
gcagaagtcatggcctatatacacacaatgaatccttctgttttggaggactggaacttt
ggtttatcgcctccaccaaatggtacactggaggatacttatagatatgtacagtcacag
gccattacctgtcagaaacccacacctgaaaaagaaaaacaggatccctataaggatatg
agtttttgggaggttaacttaaaagaaaagttttcaagtgaattagatcagtttcccctt
ggacgtaagtttttattgcaaagtggatatcgaggacggacgtctgctcgtacaggtata
aagcgcccagctgtgtctaagccctctacagcccccaaacgaaaacgtaccaaaaccaaa
aagtaa
atgtggagaccttctgacagcacagtttatgttcctcctcctaaccctgtttcaaaggtg
gtggccactgacgcctatgtgaaaagaaccaacattttctaccatgcctcaagctcaagg
cttcttgctgtgggacacccttactactctatcaagaaggtgaacaagacagtggtacca
aaggtgtcaggctaccaatacagagtgttcaaggttgtgctcccagaccctaacaagttt
gcattgcctgactcctccctctttgaccccactacacaaaggttggtctgggcctgcaca
ggattggaggtgggaagaggtcaacctttgggagtgggtgtgagtggacacccacttctc
aacaaatatgatgatgtggagaacagtggtggatatggtggtaatcctggtcaagataac
agggtgaatgttggtatggattacaagcaaactcagctctgcatggtgggctgtgctcca
ccattgggtgagcactggggtaagggcacacaatgctccaacacttctgtgcaaaatggt
gattgcccaccattggagcttatcacaagtgtgatccaagatggagatatggtggataca
ggctttggtgctatgaactttgctgacctccagactaacaaatcagatgtgccccttgat
atctgtggaactgtctgcaaataccctgactaccttcagatggctgctgatccttatggt
gacaggcttttcttctacctcaggaaggaacagatgtttgctaggcacttcttcaatagg
gctggtactgttggcgagccagttcctgatgatctcttggttaagggaggcaacaacaga
tcttcagttgcttcatcaatctatgtgcacaccccaagtggctccttggtttcttcagag
gctcagttgttcaacaaaccatactggcttcaaaaggctcagggacacaacaatggtatc
tgctggggaaatcacctctttgttactgtggttgacacaaccagatcaactaacatgaca
ctttgtgcatctgtgtccaagtctgctacttacactaactcagattacaaggagtacatg
aggcatgtggaggagtttgacctccagttcatcttccagctctgtagcatcaccttgtct
gctgaggtcatggcctacattcacaccatgaatccatctgttttggaggattggaatttt
ggcttgagcccaccaccaaatggcactcttgaggacacctacagatatgttcaatcacaa
gccatcacatgccagaagcctactccagagaaagagaaacaagacccctacaaggacatg
agtttctgggaggtgaacttgaaggagaagttctcaagtgagttggaccaattccccctt
ggaaggaagttcttgcttcagagtggatatagaggaaggacctctgccagaacaggcatt
taa
5' End
3' End
NotesNatural gene, which codes for the protein, begins at 4557bp of the accession numbered gene.
Expression VectorpPS1
Assay MethodsWestern Blot, Northern Blot
ResultsVery little increase (L1 production may have interfered with growth and not full length protein)
Protein FunctionMajor capsid protein, influences production of VLPs (virus-like particles)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons from natural gene were changed based on the codon usage patterns of highly expressed
dicotyledonous plants. NLS sequence was removed.
Publication Author(s)Warzecha, H.; Mason, H. S.; Lane, C.; Tryggvesson, A.; Rybicki, E.; Williamson, A. L.; Clements, J. D.; Rose, R. C.
Corresponding AuthorRobert C. Rose
Corresponding AddressBoyce Thompson Institute for Plant Research, Ithaca, New York 14850, USA.
Publication Year2003
Publication TitleOral immunogenicity of human papillomavirus-like particles expressed in potato
AbstractHuman papillomavirus-like particles (HPV VLPs) have shown considerable promise as a parenteral vaccine for the prevention of cervical cancer and its precursor lesions. Parenteral vaccines are expensive to produce and deliver, however, and therefore are not optimal for use in resource-poor settings, where most cervical HPV disease occurs. Transgenic plants expressing recombinant vaccine immunogens offer an attractive and potentially inexpensive alternative to vaccination by injection. For example, edible plants can be grown locally and can be distributed easily without special training or equipment. To assess the feasibility of an HPV VLP-based edible vaccine, in this study we synthesized a plant codon-optimized version of the HPV type 11 (HPV11) L1 major capsid protein coding sequence and introduced it into tobacco and potato. We show that full-length L1 protein is expressed and localized in plant cell nuclei and that expression of L1 in plants is enhanced by removal of the carboxy-terminal nuclear localization signal sequence. We also show that plant-expressed L1 self-assembles into VLPs with immunological properties comparable to those of native HPV virions. Importantly, ingestion of transgenic L1 potato was associated with activation of an anti-VLP immune response in mice that was qualitatively similar to that induced by VLP parenteral administration, and this response was enhanced significantly by subsequent oral boosting with purified insect cell-derived VLPs. Thus, papillomavirus L1 protein can be expressed in transgenic plants to form immunologically functional VLPs, and ingestion of such material can activate potentially protective humoral immune responses.
JournalJ Virol. 77(16): 8702-11.
SummaryPotato plants were transformed with L1s and L1st, recoded versions of the L1 gene, in order to increase the expression of protein in potato plants. Changing codons of L1 based on the codon usage patterns of dicotyledonous plants was how L1s and L1st were recoded. L1s did not yield any protein, L1st did yielded protein, but in very small amount and without full length protein. The L1s failed at its goal and the L1st did not do very well. Overall, the recoding was not successful.
CommentsNatural gene, which codes for the protein, begins at 4557bp of the accession numbered gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=543
PubMed ID12885889
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site