Synthetic Gene DataBase
 

Synthetic Gene 107


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID93107
GenBank AccessionAF287353
GenBank GI11066864
Gene Namegag-polgag-pol fusion protein
Gene Length (bp)04308
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens
StrainsType1293T, COS-1, NIH 3T3
CDSatgggcgccagggccagcgtgctgagcgccggcgagctggacaagtgggagaagatcagg
ctgaggcccggcggcaagaagcagtacaggctgaagcacatcgtgtgggccagcagggag
ctggagaggttcgccgtggaccccggcctgctggagaccagcgagggctgcaggcagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgaggagcctgtacaac
accgtggccaccctgtactgcgtgcaccagaagatcgaggtgaaggacaccaaggaggcc
ctggagaagatcgaggaggagcagaacaagagcaagaagaaggcccagcaggccgccgcc
gacaccggcaacagcagccaggtgagccagaactaccccatcgtgcagaacctgcagggc
cagatggtgcaccaggccatcagccccaggaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggcgccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacaggctgcaccccgtgcacgcc
ggccccatcgcccccggccagatgagggagcccaggggcagcgacatcgccggcaccacc
agcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtgggcgag
atctacaagaggtggatcatcctgggcctgaacaagatcgtgaggatgtacagccccacc
agcatcctggacatcaggcagggccccaaggagcccttcagggactacgtggacaggttc
tacaagaccctgagggccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggccccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
agggtgctggccgaggccatgagccaggtgaccaacagcgccaccatcatgatgcagagg
ggcaacttcaggaaccagaggaagaccgtgaagtgcttcaactgcggcaaggagggccac
atcgccaagaactgcagggcccccaggaagaagggctgctggaagtgcggcaaggagggc
caccagatgaaggactgcaccgagaggcaggccaacttcctgagggaggacctggccttc
ccccagggcaaggccaggaagttcagcagcgagcagaccagggccaacagccccatcagg
agggagaggcaggtgtggaggagggacaacaacagcctgagcgaggccggcgccgacagg
cagggcaccgtgagcttcagcttcccccagatcaccctgtggcagaggcccctggtgacc
atcaagatcggcggccagctgaaggaggccctgctggacaccggcgccgacgacaccgtg
ctggaggagatgaacctgcccggcaggtggaagcccaagatgatcggcggcatcggcggc
ttcatcaaggtgaggcagtacgaccagatccccatcgagatctgcggccacaaggccatc
ggcaccgtgctggtgggccccacccccgtgaacatcatcggcaggaacctgctgacccag
atcggctgcaccctgaacttccccatcagccccatcgagaccgtgcccgtgaagctgaag
cccggcatggacggccccaaggtgaagcagtggcccctgaccgaggagaagatcaaggcc
ctggtggagatctgcaccgagatggagaaggagggcaagatcagcaagatcggccccgag
aacccctacaacacccccgtgttcgccatcaagaagaaggacagcaccaagtggaggaag
ctggtggacttcagggagctgaacaagaggacccaggacttctgggaggtgcagctgggc
atcccccaccccgccggcctgaagaagaagaagagcgtgaccgtgctggacgtgggcgac
gcctacttcagcgtgcccctgcacgaggacttcaggaagtacaccgccttcaccatcccc
agcatcaacaacgagacccccggcaccaggtaccagtacaacgtgctgccccagggctgg
aagggcagccccgccatcttccagagcagcatgaccaccatcctggagcccttcaggaag
cagaaccccgacctggtgatctaccagtacatggacgacctgtacgtgggcagcgacctg
gagatcggccagcacaggaccaagatcgaggagctgaggcagcacctgctgaggtggggc
ttcaccacccccgacaagaagcaccagaaggagccccccttcctgtggatgggctacgag
ctgcaccccgacaagtggaccgtgcagcccatcgtgctgcccgagaaggacagctggacc
gtgaacgacatccagaagctggtgggcaagctgaactgggccagccagatctacgccggc
atcaaggtgaggcagctgtgcaagctgctgaggggcaccaaggccctgaccgaggtgatc
cccctgaccgaggaggccgagctggagctggccgagaacagggagatcctgaaggagccc
gtgcacggcgtgtactacgaccccagcaaggacctgatcgccgagatccagaagcagggc
cagggccagtggacctaccagatctaccaggagcccttcaagaacctgaagaccggcaag
tacgccaggaccaggggcgcccacaccaacgacgtgaagcagctgaccgaggccgtgcag
aagatcgccaccgagagcatcgtgatctggggcaagacccccaagttcaagctgcccatc
cagaaggagacctgggagacctggtggaccgagtactggcaggccacctggatccccgag
tgggagttcgtgaacaccccccccctggtgaagctgtggtaccagctggagaaggagccc
atcatcggcgccgagaccttctacgtggacggcgccgccaacagggagaccaagctgggc
aaggccggctacgtgaccaacaagggcaggcagaaggtggtgagcctgaccgacaccacc
aaccagaagaccgagctgcaggccatctacctggccctgcaggacagcggcctggaggtg
aacatcgtgaccgacagccagtacgccctgggcatcatccaggcccagcccgacaggagc
gagagcgagctggtgagccagatcatcgagcagctgatcaagaaggagaaggtgtacctg
gcctgggtgcccgcccacaagggcatcggcggcaacgagcaggtggacaagctggtgagc
gccggcatcaggaaggtgctgttcctggacggcatcgacaaggcccaggaggagcacgag
aagtaccacagcaactggagggccatggccagcgacttcaacctgccccccgtggtggcc
aaggagatcgtggccagctgcgacaagtgccagctgaagggcgaggccatgcacggccag
gtggactgcagccccggcatctggcagctggactgcacccacctggagggcaaggtgatc
ctggtggccgtgcacgtggccagcggctacatcgaggccgaggtgatccccgccgagacc
ggccaggagaccgcctacttcctgctgaagctggccggcaggtggcccgtgaccaccatc
cacaccgacaacggcagcaacttcaccagcgccaccgtgaaggccgcctgctggtgggcc
ggcatcaagcaggagttcggcatcccctacaacccccagagccagggcgtggtggagagc
atgaacaaggagctgaagaagatcatcggccaggtgagggaccaggccgagcacctgaag
accgccgtgcagatggccgtgttcatccacaacttcaagaggaagggcggcatcggcggc
tacagcgccggcgagaggatcgtggacatcatcgccaccgacatccagaccaaggagctg
cagaagcagatcaccaagatccagaacttcagggtgtactacagggacagcagggacccc
ctgtggaagggccccgccaagctgctgtggaagggcgagggcgccgtggtgatccaggac
aacagcgacatcaaggtggtgcccaggaggaaggccaagatcatcagggactacggcaag
cagatggccggcgacgactgcgtggccggcaggcaggacgaggactag
5' End
3' End
NotesThe natural gene was not used in the experiments. Source is not providedIf combine with pcDNA3gagml, efficient expression is resulted.
Expression VectorpcDNA3gagpolfusionml
Assay MethodsWestern Blot, Statistical analysis
Resultsnot efficient expression.
Protein Function
Recoding Purposeto support efficient expression
Synthesized ByAuthors
Recoding Methodused optimal codon usage for mammalian gene expression.
Publication Author(s)Fuller, M.; Anson, D. S.
Corresponding AuthorD.S. Anson
Corresponding AddressDepartment of Chemical Pathology, Women's and Children's Hospital, North Adelaide South Australia, 5006.
Publication Year2001
Publication TitleHelper plasmids for production of HIV-1-derived vectors
AbstractVectors derived from human immunodeficiency virus type 1 (HIV-1) appear an attractive option for many gene therapy applications. This is due to their ability to transduce noncycling cell populations and to integrate their genome into the host cell chromosome, resulting in the stable genetic modification of the transduced cell. These properties have permitted the direct in vivo transduction of several tissues, including the central nervous system, retina, and liver. However, the pathogenic nature of HIV-1 has raised considerable concerns about the safety of such vector systems. To help address these concerns, we have expressed each of the primary transcriptional units encoding trans functions relevant for vector production in individual plasmid constructs. The gag-pol gene sequence was codon-optimized for expression in mammalian cells resulting in high level Rev/Rev-response element (RRE)-independent expression. Codon optimization of gag-pol also reduces sequence homology with vectors containing gag gene sequences, which results in reduced transfer of biologically active gag-pol sequences to transduced cells. Furthermore, the vif reading frame overlapping the 3' end of the pol coding sequence is destroyed by codon optimization. We have also shown that the Gag and Gag-Pol polyproteins can be efficiently expressed from separate transcriptional units. This has enabled the removal of a cis-acting viral element, the gag-pol translational frameshift sequence, from the vector/packaging system and prevents detectable transfer of biologically active sequences equivalent to the gag-pol gene to transduced cells.
JournalHum Gene Ther. 12(17): 2081-93.
SummaryTo facilitate the production of recombinant virus for gene therapy studies with increased safety, a series of constructs were made for the expression of HIV1 proteins and combined with a suitable vectors. The synthetic constructs for gag-pol(gagpolml), gag (gagml), and pol (polml) genes were made based on the optimal codon usage for mammalian gene expression. The variant of the synthetic gag-pol sequence, gagpolfusionml , in which the frameshift of the region of overlap between the reading frames encoding gag pol were replaced by codon- optimized sequence encoding gag-pol polyprotein. According to the experimental results, codon-optimized gag-pol gene sequence (pcDNA3gagpolml) showed expression and virus production efficiently, the expressions of codon optimized gag (pcDN3gagml), pol (pcDNA3polm), and pcDNA3gagpolfusionml on their own can not support the production of virus however. In contrast, the combination of the two plasmids pcDN3gagm and pcDNA3gagpolfusionml can replace the pcDNA3gagpolml codon-optimized construct.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=661
PubMed ID11747598
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site