Synthetic Gene DataBase
 

Synthetic Gene 11


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID1111
GenBank AccessionK03455
GenBank GI1906382
Gene Namegag-polsyngp
Gene Length (bp)43074307
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1293T cells
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtgatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtgcatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaggaaccctttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaattcagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagattgttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtctggggtagagacaacaactccccctcagaagcaggagccgatagac
aaggaactgtatcctttaacttccctcaggtcactctttggcaacgacccctcgtcacaa
taaagataggggggcaactaaaggaagctctattagatacaggagcagatgatacagtat
tagaagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaattggaggtt
ttatcaaagtaagacagtatgatcagatactcatagaaatctgtggacataaagctatag
gtacagtattagtaggacctacacctgtcaacataattggaagaaatctgttgactcaga
ttggttgcactttaaattttcccattagccctattgagactgtaccagtaaaattaaagc
caggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagcat
tagtagaaatttgtacagagatggaaaaggaagggaaaatttcaaaaattgggcctgaaa
atccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaat
tagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaa
taccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatg
catatttttcagttcccttagatgaagacttcaggaagtatactgcatttaccataccta
gtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatgga
aaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaac
aaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttag
aaatagggcagcatagaacaaaaatagaggagctgagacaacatctgttgaggtggggac
ttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaac
tccatcctgataaatggacagtacagcctatagtgctgccagaaaaagacagctggactg
tcaatgacatacagaagttagtggggaaattgaattgggcaagtcagatttacccaggga
ttaaagtaaggcaattatgtaaactccttagaggaaccaaagcactaacagaagtaatac
cactaacagaagaagcagagctagaactggcagaaaacagagagattctaaaagaaccag
tacatggagtgtattatgacccatcaaaagacttaatagcagaaatacagaagcaggggc
aaggccaatggacatatcaaatttatcaagagccatttaaaaatctgaaaacaggaaaat
atgcaagaatgaggggtgcccacactaatgatgtaaaacaattaacagaggcagtgcaaa
aaataaccacagaaagcatagtaatatggggaaagactcctaaatttaaactgcccatac
aaaaggaaacatgggaaacatggtggacagagtattggcaagccacctggattcctgagt
gggagtttgttaatacccctcccttagtgaaattatggtaccagttagagaaagaaccca
tagtaggagcagaaaccttctatgtagatggggcagctaacagggagactaaattaggaa
aagcaggatatgttactaatagaggaagacaaaaagttgtcaccctaactgacacaacaa
atcagaagactgagttacaagcaatttatctagctttgcaggattcgggattagaagtaa
acatagtaacagactcacaatatgcattaggaatcattcaagcacaaccagatcaaagtg
aatcagagttagtcaatcaaataatagagcagttaataaaaaaggaaaaggtctatctgg
catgggtaccagcacacaaaggaattggaggaaatgaacaagtagataaattagtcagtg
ctggaatcaggaaagtactatttttagatggaatagataaggcccaagatgaacatgaga
aatatcacagtaattggagagcaatggctagtgattttaacctgccacctgtagtagcaa
aagaaatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatggacaag
tagactgtagtccaggaatatggcaactagattgtacacatttagaaggaaaagttatcc
tggtagcagttcatgtagccagtggatatatagaagcagaagttattccagcagaaacag
ggcaggaaacagcatattttcttttaaaattagcaggaagatggccagtaaaaacaatac
atactgacaatggcagcaatttcaccggtgctacggttagggccgcctgttggtgggcgg
gaatcaagcaggaatttggaattccctacaatccccaaagtcaaggagtagtagaatcta
tgaataaagaattaaagaaaattataggacaggtaagagatcaggctgaacatcttaaga
cagcagtacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggt
acagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattac
aaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccac
tttggaaaggaccagcaaagctcctctggaaaggtgaaggggcagtagtaatacaagata
atagtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattatggaaaac
agatggcaggtgatgattgtgtggcaagtagacaggatgaggattag
atgggcgcccgcgccagcgtgctgtcgggcggcgagctggaccgctgggagaagatccgc
ctgcgccccggcggcaaaaagaagtacaagctgaagcacatcgtgtgggccagccgcgaa
ctggagcgcttcgccgtgaaccccgggctcctggagaccagcgaggggtgccgccagatc
ctcggccaactgcagcccagcctgcaaaccggcagcgaggagctgcgcagcctgtacaac
accgtggccacgctgtactgcgtccaccagcgcatcgaaatcaaggatacgaaagaggcc
ctggataaaatcgaagaggaacagaataagagcaaaaagaaggcccaacaggccgccgcg
gacaccggacacagcaaccaggtcagccagaactaccccatcgtgcagaacatccaggtg
cagatggtgcaccaggccatctccccccgcacgctgaacgcctgggtgaaggtggtggaa
gagaaggctgttagcccggaggtgatacccatgttctcagccctgtcagagggagccacc
ccccaagatctgaacaccatgctcaacacagtggggggacaccaggccgccatgaagatg
ctgaaggagaccatcaatgaggaggctgccgaatgggatcgtgtgcatccggtgcacgca
gggcccatcgcaccgggccagatgcgtgagccacggggctcagacatcgccggaacgact
agtacccttcaggaacagatcggctggatgaccaacaacccacccatcccggtgggagaa
atctacaaacgctggatcatcctgggcctgaacaagatcgtgcgcatgtaatgccctacc
agcatcctggacatccgccaaggcccgaaggaaccctttcgcgactacgtggaccggttc
tacaaaacgctccgcgccgagcaggctagccaggaggtgaagaactggatgaccgaaacc
ctgctggtccagaacgcgaacccggactgcaagacgatcctgaaggccctgggcccagcg
gctaccctagaggaaatgatgaccgcctgtcagggagtgggcggacccggccacaaggca
cgcgtcctggctgaggccatgagccaggtgaccaactccgctaccatcatgatgcagcgc
ggcaactttcggaaccaacgcaagatcgtcaagtgcttcaactgtggcaaagaagggcac
acagcccgcaactgcagggcccctaggaaaaagggctcttggaaatctggaaaggaagga
caccaaatcaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
cacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtttggggaagagacaacaactccctctcagaagcaggagccgatagac
aaggaactgtatcctttagcttccctcagatcactctttggcagcgacccctcgtcacaa
taaagataggggggcagctcaaggaggctctcctggcacccggagcagacgacaccgtgc
tggaggagatgtcgttgccaggccgctggaagccgaagatgatcgggggaatcggcggtt
tcatcaaggtgcgccagtatgaccagatcctcatcgaaatctgcggccacaaggctatcg
gtaccgtgctggtgggccccacacccgtcaacatcatcggacgcaacctgttgacgcaga
tcggttgcacgctgaacttccccattagccctatcgagacggtaccggtgaagctgaagc
ccgggatggacggcccgaaggtcaagcaatggccattgacagaggagaagatcaaggcac
tggtggagatttgcacagagatggaaaaggaagggaaaatctccaagattgggcctgaga
acccgtacaacacgccggtgttcgcaatcaagaagaaggactcgacgaaatggcgcaagc
tggtggacttccgcgagctgaacaagcgctcgcaagacttctgggaggttcagctgggca
tcccgcaccccgcagggctgaagaagaagaaatccgtgaccgtactggatgtgggtgatg
cctacttctccgttcccctggacgaagacttcaggaagtacactgccttcacaatccctt
cgatcaacaacgagacaccggggattcgatatcagtacaacgtgctgccccagggctgga
aaggctctcccgcaatcttccagagtagcatgaccaaaatcctggagcctttccgcaaac
agaaccccgacatcgtcatctatcagtacatggatgacttgtacgtgggctctgatctag
agatagggcagcaccgcaccaagatcgaggagctgcgccagcacctgttgaggtggggac
tgaccacacccgacaagaagcaccagaaggagcctcccttcctctggatgggttacgagc
tgcaccctgacaaatggaccgtgcagcctatcgtgctgccagagaaagacagctggactg
tcaacgacatacagaagctggtggggaagttgaactgggccagtcagatttacccaggga
ttaaggtgaggcagctgtgcaaactcctccgcggaaccaaggcactcacagaggtgatcc
ccctaaccgaggaggccgagctcgaactggcagaaaaccgagagatcctaaaggagcccg
tgcacggcgtgtactatgacccctccaaggacctgatcgccgagatccagaagcaggggc
aaggccagtggacctatcagatttaccaggagcccttcaagaacctgaagaccggcaagt
acgcccggatgaggggtgcccacactaacgacgtcaagcagctgaccgaggccgtgcaga
agatcaccaccgaaagcatcgtgatctggggaaagactcctaagttcaagctgcccatcc
agaaggaaacctgggaaacctggtggacagagtattggcaggccacctggattcctgagt
gggagttcgtcaacacccctcccctggtgaagctgtggtaccagctggagaaggagccca
tagtgggcgccgaaaccttctacgtggatggggccgctaacagggagactaagctgggca
aagccggatacgtcactaaccggggcagacagaaggttgtcaccctcactgacaccacca
accagaagactgagctgcaggccatttacctcgctttgcaggactcgggcctggaggtga
acatcgtgacagactctcagtatgccctgggcatcattcaagcccagccagaccagagtg
agtccgagctggtcaatcagatcatcgagcagctgatcaagaaggaaaaggtctatctgg
cctgggtacccgcccacaaaggcattggcggcaatgagcaggtcgacaagctggtctcgg
ctggcatcaggaaggtgctattcctggatggcatcgacaaggcccaggacgagcacgaga
aataccacagcaactggcgggccatggctagcgacttcaacctgccccctgtggtggcca
aagagatcgtggccagctgtgacaagtggcagctcaagggcgaagccatgcatggccagg
tggactgtagccccggcatctggcaactcgattgcacccatctggagggcaaggttatcc
tggtagccgtccatgtggccagtggctacatcgaggccgaggtcattcccgctgaaacag
ggcaggagacagcctacttcctcctgaagctggcaggccggtggccagtgaagaccatcc
atactgacaatggcagcaatttcaccagtgctacggttaaggccgcctgctggtgggcgg
gaatcaagcaggagttcgggatcccctacaatccccagagtcagggcgtcgtcgagtcta
tgaataaggagttaaagaagattatcggccaggtcagagatcaggcagagcatctcaaga
ccgcggtccaaatggcggtattcatccacaatttcaagcggaagggggggattggtgggt
acagtgcgggggagcggatcgtggacatcatcgcgaccgacatccagactaaggagctgc
aaaagcagattaccaagattcagaatttccgggtctactacagggacagcagaaatcccc
tctggaaaggcccagcgaagctcctctggaatggtgagggggcagtagtgatccaggata
atagcgacatcaaggtggtgcccagaagaaaggcgaagatcattagggattatggcaaac
agatggcgggtgatgattgcgtggcgagcagacaggatgaggattag
5' End
3' End
Notes
Expression VectorpWI3 and pNL4-3, pGP-RRE3pSYNG
Assay MethodsWestern blotting, Nothern blotWestern blot, Northern blot
ResultsLow expression10 fold higher than wild-type
Protein FunctionEnzyme precursor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe codon-optimized gag-pol gene was constructed by annealing a series of short overlapping
oligonucleotides (approximately 30- to 40-mers; 9 nt of overlap). Codon optimization was performed
using the sequence of the HXB2 strain. A fragment from base 1222 from the beginning of gag until the
end of gag (base 1503) was not optimized in order to maintain the frameshift site and the overlap
between the gag and pol reading frames. This was from clone pNL4-3. The Kozak consensus sequence for
optimal translation initiation was also included. Full optimization for the first 1221bp with the
reference codon usage in highly expressed human genes
(GCA13,GCC53,GCG17,GCT17,AGA10,AGG18,CGA6,CGC37,CGG21,CGT7,
AAC78,AAT22,GAC75,GAT25,TGC68,TGT32,CAA12,CAG88,GAA25,GAG75,
GGA14,GGC50,GGG24,GGT12,CAC79,CAT21,ATA5,ATC18,ATT77,CTA3,
CTC26,CTG58,CTT5,TTA2,TTG6,AAA18,AAG82,TTC80,TTT20,CCA16,
CCC48,CCG17,CCT19,AGC34,AGT10,TCA5,TCC28,TCG9,TCT13,ACA14,
ACC57,ACG15,ACT14,TAC74,TAT26,GTA5,GTC25,GTG64,GTT7)
Publication Author(s)Kotsopoulou, E.Kim, V. N. Kingsman, A. J.Kingsman, S. M., Mitrophanous, K. A.
Corresponding AuthorSuan M. Kingsman
Corresponding AddressRetrovirus Molecular Biology Group, Department of Biochemistry, University of Oxford, Oxford OX1 3QU, United Kingdom.
Publication Year2000
Publication TitleA Rev-independent human immunodeficiency virus type 1 (HIV-1)-based vector that exploits a codon-optimized HIV-1 gag-pol gene
AbstractThe human immunodeficiency virus (HIV) genome is AU rich, and this imparts a codon bias that is quite different from the one used by human genes. The codon usage is particularly marked for the gag, pol, and env genes. Interestingly, the expression of these genes is dependent on the presence of the Rev/Rev-responsive element (RRE) regulatory system, even in contexts other than the HIV genome. The Rev dependency has been explained in part by the presence of RNA instability sequences residing in these coding regions. The requirement for Rev also places a limitation on the development of HIV-based vectors, because of the requirement to provide an accessory factor. We have now synthesized a complete codon-optimized HIV-1 gag-pol gene. We show that expression levels are high and that expression is Rev independent. This effect is due to an increase in the amount of gag-pol mRNA. Provision of the RRE in cis did not lower protein or RNA levels or stimulate a Rev response. Furthermore we have used this synthetic gag-pol gene to produce HIV vectors that now lack all of the accessory proteins. These vectors should now be safer than murine leukemia virus-based vectors.
JournalJ Virol. 74(10): 4839-52.
SummaryUsually the expression of gag-pol gene is dependent on the presence of Rev. In this study, codon optimization has overcome this dependence, making the generation of Rev-independent vectors possible. Furthermore, the codon optimization improved the yields of proteins. However, this increase seems to be a result of the increase in mRNA abundance rather than the increase in translational efficiency.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=516
PubMed ID10775623
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site