Synthetic Gene DataBase
 

Synthetic Gene 111


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID97111
GenBank AccessionM15654
GenBank GI326383
Gene Namewtgagsyngag
Gene Length (bp)15391539
SpeciesHuman immunodeficiency virus 1 (HIV-1)Homo sapiens
Strainstype 1H1299
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' End
3' End
Notesgag polyprotein precursor.Sequence is from Graf et al.,2000
Expression VectorpcDNA 3.1(+)pcDNA3.1+
Assay MethodsELISA, Western BlotELISA, Western Blot
ResultsLow expression.increased expression
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe syngag was designed on the basic of the Pr55gag amino acid sequence employing a codon
usage occurring most frequently in highly expressed mammalian genes. By this procedure, almost
every wooble position within the wild-type coding region was changed to a G or C, resulting in a
diverse nucleotide composition and decreased AT content.
Publication Author(s)Kofman, A.; Graf, M.; Deml, L.; Wolf, H.; Wagner, R.
Corresponding AuthorAlexander Kofman
Corresponding AddressInstitute for Medical Microbiology and Hygiene, University of Regensburg, D-93053 Regensburg, Germany.
Publication Year2003
Publication TitleCodon usage-mediated inhibition of HIV-1 gag expression in mammalian cells occurs independently of translation
AbstractCodon usage is considered one of the critical factors that limit the expression rate of heterologous genes. Impaired translation efficiency, specifically insufficient amount of corresponding tRNAs and changed startcodon context, are believed to account for the low translation initiation and elongation rates during the protein biosynthesis in unicellular organisms. Translational efficiency is probably not the primary factor influencing codon usage diversity in mammalian cells. However, the other possible mechanisms preventing expression of genes with low-usage such as mRNA stability, processing and nucleocytoplasmic transport, are not adequately explored. In our work, we addressed the question of whether codon usage differences affect exclusively translational efficiency of mammalian gene products. We demonstrated that the CMV-induced expression of gag-reporter in human H1299 cell line was influenced by the nucleotide composition of the mRNA, and the limitation of gag expression appeared to be inversely related to the level of codon optimization. However, cytoplasmic expression of the gag-reporter driven by vaccinia virus/T7 RNA polymerase hybrid system rescued its expression independently of HIV-1 gag mRNA nucleotide content. We concluded that impaired HIV-1 gag expression may be caused by translation-independent mechanisms, which probably play a major role in codon usage-mediated defects in heterologous gene expression in mammalian cells.
JournalTsitologiia. 45(1): 94-100.
SummaryTo determine whether codon usage differences affect exclusively translational efficiency of mammalian genes products, wild type gag (wtgag) and synthetic gag (syngag) genes were used in the experiments. Synthetic gene was designed on the basic of the Pr55gag amino acid sequence employing a codon usage occurring most frequently in highly expressed mammalian genes. By this procedure, almost every wooble position within the wild-type coding region was changed to a G or C, resulting in a diverse nucleotide composition and decreased AT content. In order to study the influence of codon usage optimization on gag expression, chimeric constructs were also designed by substituting wtgag fragments with part of syngag mRNA. For nuclear expression, as expected, wtgag expression was extremely low, while the expression of cyngag was the highest among all the constructs leading to the counclusion that HIV1 gag expression depends on the mRNA nucleotide content. However, for the cytoplasmic expressions, all wtgag, syngag, and the chimeric constructs efficiently expressed.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=670
PubMed ID12683242
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site