Synthetic Gene DataBase
 

Synthetic Gene 114


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID105114
GenBank AccessionM15654
GenBank GI326383
Gene Namewtgagsyngag
Gene Length (bp)15391539
SpeciesHuman immunodeficiency virus 1 (HIV-1)Homo sapiens
Strainstype 1H1299
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' End
3' End
NotesSequence is from Graf et al.,2000
Expression VectorpcDNA 3.1(+)pcDNA3.1+
Assay MethodsWestern Blot, Immunoblotting, P24 capture assay,Luciferase assay,ELISA, Western Blot
ResultsLow expression.Significant increase.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe syngag was designed on the basic of the Pr55gag amino acid sequence employing a codon usage
occurring most frequently in highly expressed mammalian genes. By this procedure, almost every
wooble position within the wild-type coding region was changed to a G or C, resulting in a diverse
nucleotide composition and decreased AT content.
Publication Author(s)Kofman, A.; Graf, M.; Deml, L.; Kharazova, A.; Wolf, H.; Wagner, R.
Corresponding AuthorRalf Wagner
Corresponding AddressInstitute for Medical Microbiology and Hygiene, University of Regensburg, D-93053 Regensburg, Germany.
Publication Year2003
Publication TitleCo-influence of transgene expression in mammalian cells. Mutual influence of transgenes on their expression in mammalian cells
AbstractIt becomes increasingly clear that therapeutic gene delivery should provide not only for the sustained high level of gene expression but also, in most cases, for the regulated expression of transgenes as much as it occurs under natural conditions. Over the past few years a variety of different systems have been developed in order to regulate the amounts of transcribed RNA upon administration of exogenous agents, or in autoregulated manner. While efforts were focused on optimizing gene expression at the transcriptional level, other levels are still overlooked. In the meantime, regulation of gene expression is not restricted to transcription, but is also executed at the post-transcriptional level, i.e. mRNA stability, processing, transport, translation, protein stability, and modification. Codon usage is considered to be one of the critical factors that limit the expression rate of heterologous genes in different organisms at the posttranscriptional level. HIV-1 structural genes gag, pol, and env represent one of the most extensively utilized models for studying codon usage-mediated effects on transgene expression. In the current work we demonstrate that the codon content affects not only CMV-driven HIV-1 gag expression but also the expression of luciferase reporter gene transcribed independently from the SV40 promoter. The expression levels of both transgenes co-transfected into the human H1299 were inversely co-dependent. The observed phenomenon may be described as sequence-independent post-transcriptional gene silencing, which reflects the existing limitation of transgene expression in mammalian cells at the post-transcriptional level. Optimization of the codon usage may provide for the additional level of regulation of transgene expression in gene transfer experiments in order to maintain the concentration of the protein at the therapeutic levels.
JournalTsitologiia. 45(4): 387-91.
SummaryThe purpose is to demonstrate that the codon content affects not only CMV driven HIV1 gag expression but also the expression of luciferase reporter gene transcribed independently from the SV40 promoter. For this purpose, H1299 cell were co-transfected with luciferase-expressing pGL3 and pcDNA3.1+ plasmid, which encoded HIV gag chimeric (Ch) constructs with different ratios of wild type and optimized codons within mRNAs. Chimeric mRNA expression constructs were prepared as desdescribed earlier (Kofman et al., 2003a) through the substitution of syngag fragments for wtgag ones , which were generated by PCR. The construction of syngag with optimized codon usage is also described previously (Graf et al., 2000). The results show that when liciferase –encoding vector was transfected alone, the expression of luciferase was the highest in all the experiments. However, co-transfection with pcDNA3.1+ decreased the expression of luciferase. The level of luciferase expression was inversely related to the Pr55 gag levels. In contrast, the level of luciferase expression was directly proportional to the wt codon mRNA content of the gag reporter.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=669
PubMed ID14520870
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site