Synthetic Gene DataBase
 

Synthetic Gene 116


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID107116
GenBank AccessionAF286224AY181196
GenBank GI1356921737414008
Gene Namepolpol
Gene Length (bp)30002550
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
Strains96ZM651293T cells, mouse spleen cells
CDSttttttagggaaaatttggccttcccacaagggaaggccagggaatttccttcagaacag
gccagagccaacagccccaccagcagagagcttcaggttcgaggagacaacccccgctcc
gaagcaggagtcgaaagacagggaagccttaacttccctcaaatcactctttggcagcga
ccccttgtctcaataaaggtagggggccaaataaaggaggctctcttagacacgggagca
ggtgatacagtattagaagaaataaatttgccaggcaaatggaaaccaaaaatgatagga
ggaattggaggctttatcgaagtaagacaatatgatcaaatacctatggaaatttgtgga
aaaaaggctataggtacagtattagtaggacctacacctgtcaacataattggaagaaat
atgttgactcagcttggatgcacactaaattttccaattagtcctattgaaactgtacca
gtaaaattaaagccaggaatggatggcccaaaggttaaacaatggccattgacagaagag
aaaataaaagctttaacagcaatttgtgaagaaatggagaaggaaggaaaaattacaaaa
attgggcctgaaaatccatataacactccagtatttgccataaaaaagaaggacagtact
aagtggcgaaaattagtagatttcagggaactcaataaaagaactcaagacttttgggaa
gttcaattaggaataccacacccagcagggttaaaaaagaaaaaatcagtgacagtactg
gatgtgggggatgcatatttttcagttcctttagatgaaagcttcaggaaatatactgca
ttcaccatacctagtacaaacaatgaaacaccagggattagatatcaatataatgtgctt
ccacagggatggaaaggatcaccagcaatattccagagtagcatgacaaaaatcttagag
cccttcagggcacaaaatccagacatagtcatctatcaatatatggatgacctgtatgta
ggatctgacttagaaatagggcaacatagagcaaaaatagaagagttaagagaacatcta
ttaaagtggggatttaccacaccagacaagaaacatcagaaagaacccccatttctttgg
atggggtatgaactccatcctgacaaatggacagtacagcctatacagctggcagaaaaa
gatagctggactgttaatgatatacagaagttagtgggaaaattaaactgggcaagtcag
atttacgcagggattaaagtaaggcaactttgtaaactccttaggggagccaaagcacta
acagacatagtaccactaactgaagaagcagaattagaattggcagagaacaaggaaatt
ttaaaagaaccagtacatggggtatattatgacccatcaaaagacttgatagctgaaata
cagaaacaagggcatgaccaatggacatatcaaatttaccaggaaccattcaaaaatctg
aaaacagggaagtatgcaaaaatgaggacagcccacactaatgatgtaaaacagttaaca
gaggcagtgcaaaaaatagccctggagagcatagtaatatggggaaagattcctaaattt
agactacccatccaaaaagaaacatgggaaacatggtggacagactattggcaagccacc
tggattcctgagtgggagtttgttaatacccctctcttagtaaaattatggtaccagctg
gagaaagaacccatagtaggagcagaaaccttctatgtagatggagcagccaatagggaa
actaaattaggaaaagcagggtatattactgacagaggaaggcaaaaaattgttactcta
actgaaacaacaaatcagaagactgaattacaagcaatttacctagctttgcaagattca
ggatcagaagtaaacatagtaactgactcacagtatgcgttaggaatcattcaagcacat
ccagataagagtgaatcagagttagtcaaccaaataatagaacaattaataaagaaggaa
agggtctacctgtcatgggtaccagcacataaaggaattggaggtaatgaacaggtagat
aaattagtaagcaagggaatcaggaaagtgctgtttctagatggaatagacaaggctcaa
gaagagcatgaaaaatatcacaacaattggagagcaatggctagtgaatttaatctacca
ccagtagtagcaaaagaaatagtagctagttgtgataaatgtcagcaaaaaggggaagcc
acacatggacaagtagactgtagtccagggatatggcaattagactgtacacatttagaa
ggaaaaatcatcctggtagcagtccatgtagccagtggctacatagaagcagaggttatc
ccagcagaaacaggacaagaaacagcatactatatattaaaattagcaggaagatggcca
gtcaaagtaatacatacagacaatggtagcaattttaccagtgctgcagttaaggcagcc
tgttggtgggcaggtatcaaacaagaatttggaattccctacaatccacaaagtcaggga
gtagtagaatccatgaataaagaattaaagaaaatcatagggcaggtaagagatcaggct
gagcatcttaaaacagcagtacaaatggcagtattcattcacaattttaaaagaaaaagg
gggattggggggtacagtgcaggggaaagaataatagacataatagcaacagacatacaa
accaaagaactacaaaaacaaattataaacattcaaaaatttcgggtttattacagagac
agcagagaccccatttggaaaggaccagccaaactactctggaaaggtgaaggggcagta
gtaatacaagataatagtgacataaaagtggtaccaaggaggaaagcaaaaatcattagg
gactatggaaaacagatggcaggcgctgattgtgtggcaggtagacaggatgaggattag
atgcccatcagccccatcgagaccgtgcccgtgaagctgaagcccggcatggacggcccc
aaggtgaagcagtggcccctgaccgaggagaagatcaaggccctgaccgccatctgcgag
gagatggagaaggagggcaagatcaccaagatcggccccgagaacccctacaacaccccc
gtgttcgccatcaagaagaaggacagcaccaagtggcgcaagctggtggacttccgcgag
ctgaacaagcgcacccaggacttctgggaggtgcagctgggcatcccccaccccgccggc
ctgaagaagaagaagagcgtgaccgtgctggacgtgggcgacgcctacttcagcgtgccc
ctggacgagagcttccgcaagtacaccgccttcaccatccccagcaccaacaacgagacc
cccggcatccgctaccagtacaacgtgctgccccagggctggaagggcagccccgccatc
ttccagagcagcatgaccaagatcctggagcccttccgcgcccagaaccccgacatcgtg
atctaccagtacatggacgacctgtacgtgggcagcgacctggagatcggccagcaccgc
gccaagatcgaggagctgcgcgagcacctgctgaagtggggcttcaccacccccgacaag
aagcaccagaaggagccccccttcctgtggatgggctacgagctgcaccccgacaagtgg
accgtgcagcccatccagctggccgagaaggacagctggaccgtgaacgacatccagaag
ctggtgggcaagctgaactgggccagccagatctacgccggcatcaaggtgcgccagctg
tgcaagctgctgcgcggcgccaaggccctgaccgacatcgtgcccctgaccgaggaggcc
gagctggagctggccgagaacaaggagatcctgaaggagcccgtgcacggcgtgtactac
gaccccagcaaggacctgatcgccgagatccagaagcagggccacgaccagtggacctac
cagatctaccaggagcccttcaagaacctcaagaccggcaagtacgccaagatgcgcacc
gcccacaccaacgacgtgaagcagctgaccgaggccgtgcagaagatcgccctggagagc
atcgtgatctggggcaagatccccaagttccgcctgcccatccagaaggagacctgggag
acctggtggaccgactactggcaggccacctggatccccgagtgggagttcgtgaacacc
cccctgctggtgaagctgtggtaccagctggagaaggagcccatcgtgggcgccgagacc
ttctacgtggacggcgccgccaaccgcgagaccaagctgggcaaggccggctacatcacc
gaccgcggccgccagaagatcgtgaccctgaccgagaccaccaaccagaaaaccgagctg
caggccatctacctggccctgcaggacagcggcagcgaggtgaacatcgtgaccgacagc
cagtacgccctgggcatcatccaggcccaccccgacaagagcgagagcgagctggtgaac
cagatcatcgagcagctgatcaagaaggagcgcgtgtacctgagctgggtgcccgcccac
aagggcatcggcggcaacgagcaggtggacaagctggtgagcaagggcatccgcaaggtg
ctgttcctggacggcatcgacaaggcccaggaggagcacgagaagtaccacaacaactgg
cgcgccatggccagcgagttcaacctgccccccgtggtggccaaggagatcgtggccagc
tgcgacaagtgccagcagaagggcgaggccacccacggccaggtggactgcagccccggc
atctggcagctggactgcacccacctggagggcaagatcatcctggtggccgtgcacgtg
gccagcggctacatcgaggccgaggtgatccccgccgagaccggccaggagaccgcctac
tacatcctgaagctggccggccgctggcccgtgaaggtgatccacaccgacaacggcagc
aacttcaccagcgccgccgtgaaggccgcctgctggtgggccggcatcaagcaggagttc
ggcatcccctacaacccccagagccagggcgtggtggagagcatgaacaaggagctgaag
aagatcatcggccaggtgcgcgaccaggccgagcacctcaagaccgccgtgcagatggcc
gtgttcatccacaacttcaagcgcaagcgcggcatcggcggctacagcgccggcgagcgc
atcatcgacatcatcgccaccgacatccagaccaaggagctgcagaagcagatcatcaac
atccagaagttccgcgtgtactaccgcgacagccgcgaccccatctggaagggccccgcc
aagctgctgtggaagggcgagggcgccgtggtgatccaggacaacagcgacatcaaggtg
gtgccccgccgcaaggccaagatcatccgcgactacggcaagcagatggccggcgccgac
tgcgtggccggccgccaggacgaggactag
5' End
3' End
Notes
Expression VectorpcDNA 3.1pcDNA3.1
Assay Methodsautoradiography, western blot, ELISpot, ELISAautoradiography, western blot, ELISpot, ELISA
Resultsundetectable.Significant increase
Protein Functionpol polyprotein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe codon usage of the major 96ZM651.8 gene sequences was transcribed manually to that of highly
expressed human genes by changing third-codon positions from A or T to G or C residues respectively.
A Kozak (GCCGCCGCC) sequence and a methionine codon(ATG) were added immediately before the first
codon of the reverse transcriptase(RT). The protease (PR) gene was excluded because overexpression
of PR is known to be toxic to cells.
Publication Author(s)Gao, F.; Li, Y.; Decker, J. M.; Peyerl, F. W.; Bibollet-Ruche, F.; Rodenburg, C. M.; Chen, Y.; Shaw, D. R.; Allen, S.; Musonda, R.; Shaw, G. M.; Zajac, A. J.; Letvin, N.; Hahn, B. H.
Corresponding AuthorBeatrice H. Hahn
Corresponding AddressDepartment of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA.
Publication Year2003
Publication TitleCodon usage optimization of HIV type 1 subtype C gag, pol, env, and nef genes: in vitro expression and immune responses in DNA-vaccinated mice
AbstractCodon usage optimization of human immunodeficiency virus type 1 (HIV-1) structural genes has been shown to increase protein expression in vitro as well as in the context of DNA vaccines in vivo; however, all optimized genes reported thus far are derived from HIV-1 (group M) subtype B viruses. Here, we report the generation and biological characterization of codon usage-optimized gag, pol, env (gp160, gp140, gp120), and nef genes from a primary (nonrecombinant) HIV-1 subtype C isolate. After transfection into 293T cells, optimized subtype C genes expressed one to two orders of magnitude more protein (as determined by immunoblot densitometry) than the corresponding wild-type constructs. This effect was most pronounced for gp160, gp140, Gag, and Pol (>250-fold), but was also observed for gp120 and Nef (45- and 20-fold, respectively). Optimized gp160- and gp140-derived glycoproteins were processed, incorporated into virus particles, and mediated virus entry when expressed in trans to complement an env-minus HIV-1 provirus. Mice immunized with optimized gp140 DNA developed antibody as well as CD4+ and CD8+ T cell immune responses that were orders of magnitude greater than those of mice immunized with wild-type gp140 DNA. These data confirm and extend previous studies of codon usage optimization of HIV-1 genes to the most prevalent group M subtype. Our panel of matched optimized and wild-type subtype C genes should prove valuable for studies of protein expression and function, the generation of subtype-specific immunological reagents, and the production of DNA-based sub-unit vaccines directed against a broader spectrum of viruses.
JournalAIDS Res Hum Retroviruses. 19(9): 817-23.
SummaryThe authors reported the generation and biological characterization of codon usage-optimized gag, pol, env (gp160, gp140, gp120), and nef genes from a primary HIV1 subtype C isolate. The codon usage of the major 96ZM651.8 gene sequences was transcribed manually to that of highly expressed human genes by changing third-codon positions from A or T to G or C residues respectively. None of these substitutions resulted in changes of the encoded protein sequences. Experiments were done both in vitro and vivo for the expression levels and for cellular immune responses. The experimental results showed that the codon optimized genes increased the expression levels as well as cellular immune responses.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=660
PubMed ID14585212
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site