Synthetic Gene DataBase
 

Synthetic Gene 119


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID110119
GenBank AccessionM80520
GenBank GI164526
Gene Nameporcine alpha-lactalbuminsynthetic alpha-lactalbumin
Gene Length (bp)426373
SpeciesSus scrofaZea mays
Strainscalli, kernels, leaves
CDSatgatgtcctttgtctctctcctcgtggtggggattctctttcctgccatccaggccaag
caatttacaaaatgtgagctgtcccaggtgctgaaagacatggatggctatggagacatc
actttgcctgaatggatctgtaccatatttcatatcagtggctatgacacaaaaaccatt
gtgcatgacaatggcagcacagaatatggactcttccagatcaataataaactctggtgc
agagacaaccagatccagtcaaagaacatctgtggcatctcctgtgacaaattcctggat
gatgaccttactgatgacatgatgtgtgccaagaagatcctggataatgaagggattgac
tactggttggcccataaagcactctgttcagaaaaactggatcagtggctctgtgagaag
atgtga
atgaggaagcagttcaccaagtgcgagctgtcccaggtgctcaaggacatggacggctac
ggcgacatcaccctcccggagtggatttgcaccatcttccacatctccggctacgacacc
aagaccatcgtgcacgacaacgggtctaccgagtacggcctcttccagatcaacaacaag
ctctggtgccgcgacaaccaaatccagtccaagaacatctgcggcatctcctgcgacaag
ttcctcgacgacgacctcaccgacgacatgatgtgcgccaagaagatcctcgacaacgag
ggcattgactactggctcgcccacaaggccctctgctccgagaagctcgaccagtggctc
tgcgagaagatga
5' End
3' End
NotesAccession number for natural gene given by corresponding author. No analysis of natural gene in study.CDS of recoded gene was given by corresponding author. There were 3 different contructs for transformation into the maize, pUbi/Lactal, pUbi/z-sig/Lactal, and pUbi/z-sig/Lactal/KDEL.
Expression VectorpAHC25 with marker gene, bar, and a Ubi-1 promoter
Assay MethodsSDS-PAGE, immuno-blot detection, Northern blot
ResultsSignificant increase (Only in plants transformed with constructs containing gamma zein signal)
Protein FunctionPromotes synthesis of lactose
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons from wild-type gene were modified based on the codon usage patterns of maize highly expressed
genes.
Publication Author(s)Yang, S. H.; Moran, D. L.; Jia, H. W.; Bicar, E. H.; Lee, M.; Scott, M. P.
Corresponding AuthorM. Paul Scott
Corresponding AddressInterdepartmental Genetics Program, Iowa State University, USA.
Publication Year2002
Publication TitleExpression of a synthetic porcine alpha-lactalbumin gene in the kernels of transgenic maize
AbstractThe main nutritional limitation of maize used for feed is the content of protein that is digestible, bioavailable and contains an amino acid balance that matches the requirements of animals. In contrast, milk protein has good digestibility, bioavailability and amino acid balance. As an initial effort to create maize optimized as a source of swine nutrition, a codon-adjusted version of a gene encoding the milk protein porcine alpha-lactalbumin was synthesized. Maize expression vectors containing this gene under the control of the Ubi-1 promoter and nos 3' terminator were constructed. These vectors were used to transform maize callus lines that were regenerated into fertile plants. The alpha-lactalbumin transgenes were transmitted through meiosis to the sexual progeny of the regenerated plants. Porcine alpha-lactalbumin was detected in callus and kernels from transgenic maize lines that were transformed by two constructs containing the 27-kDa maize gamma-zein signal sequence at the 5' end of the synthetic porcine alpha-lactalbumin coding sequence. One of these constructs contained an ER retention signal and the other did not. Expression was not observed in kernels or callus from transgenic maize lines that were transformed by a construct that does not contain an exogenous protein-targeting signal. This suggests that the signal peptide might play an important role in porcine alpha-lactalbumin accumulation in transgenic maize kernels.
JournalTransgenic Res. 11(1): 20-Nov.
SummaryMaize (Zea mays) was transformed with synthetic porcine alpha-lacalbumin, a recoded gene version of the natural gene porcine alpha-lacalbumin, in order to increase the expression of the porcine alpha-lacalbumin protein. The natural gene porcine alpha-lacalbumin had its codons modified based on the codon usage patterns of highly expressed maize genes. Synthetic porcine alpha-lacalbumin produced a significant increase in the amount of porcine alpha-lacalbumin and increased the frequency of plants with the protein. From this, the recoding can be considered successful in its intended goal of increasing protein expression.
CommentsNo accession number or GI given for the recoded gene. CDS of recoded gene was given by corresponding author as well as the accession number for the natural gene. There were 3 different contructs for transformation into the maize, pUbi/Lactal, pUbi/z-sig/Lactal, and pUbi/z-sig/Lactal/KDEL.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=562
PubMed ID11874099
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site