Synthetic Gene DataBase
 

Synthetic Gene 120


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID111120
GenBank AccessionL29571
GenBank GI461374
Gene NameaeqDaeqS
Gene Length (bp)591591
SpeciesAequorea victoriaNeurospora crassa, Aspergillus niger, Aspergillus awamori
Strains66A (A. awamori), 15-21 (A. awamori), 1-3 (N. crassa)
CDSatgacaagcaaacaatactcagtcaagcttacatcagacttcgacaacccaagatggatt
ggacgacacaagcatatgttcaatttccttgatgtcaaccacaatggaaaaatctctctt
gacgagatggtctacaaggcatctgatattgtcatcaataaccttggagcaacacctgag
caagccaaacgacacaaagatgctgtagaagccttcttcggaggagctggaatgaaatat
ggtgtggaaactgattggcctgcatatattgaaggatggaaaaaattggctactgatgaa
ttggagaaatacgccaaaaacgaaccaacgctcatccgtatatggggtgatgctttgttt
gatatcgttgacaaagatcaaaatggagccattacactggatgaatggaaagcatacacc
aaagctgctggtatcatccaatcatcagaagattgcgaggaaacattcagagtgtgcgat
attgatgaaagtggacaactcgatgttgatgagatgacaagacaacatttaggattttgg
tacaccatggatcctgcttgcgaaaagctctacggtggagctgtcccctaa
atgacctccaagcagtactccgtcaagcttacctccgacttcgacaacccccgctggatc
ggccgccacaagcacatgttcaacttcctcgacgtcaaccacaacggcaagatttccctc
gacgagatggtctacaaggcctccgacatcgtcatcaacaacctcggcgctacccccgag
caggccaagcgccacaaggacgccgtcgaggccttcttcggcggtgccggcatgaagtac
ggcgtcgagaccgactggcccgcctacatcgagggctggaagaagctcgccaccgacgag
ctcgagaagtacgccaagaacgagcccaccctcatccgcatctggggcgacgccctcttc
gacatcgtcgacaaggaccagaacggtgccatcaccctcgacgagtggagggcctacacc
aaggccgccggcatcattcagtccagcgaggactgcgaagagaccttccgcgtctgcgac
atcgacgagtccggccagctcgatgtcgatgagatgacccgccagcacctcggcttctgg
taccaaatggaccccgcctgcgagaagctctacggcggtgccgtcccctaa
5' End
3' End
NotesNo accession number or GI given for recoded gene.
Expression VectorpNACEQ3pNACEQ3 (N. crassa), pAEQ1-15 (A. niger, A. awamori)
Assay MethodsNorthern Blot, Southern BlotNorthern Blot, Southern Blot
ResultsSignificant amount (.15% total protein)Very high increase (45 fold more in N. crassa, and over 200 fold more in A. niger and A. awamori)
Protein FunctionProduces green fluorescent protein when bound to calcium.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodaeqD had its codons modified based on the codon usage of highly expressed genes in Neurospora
crassa, Aspergillus niger, and Aspergillus awamori.
Publication Author(s)Nelson, G.; Kozlova-Zwinderman, O.; Collis, A. J.; Knight, M. R.; Fincham, J. R.; Stanger, C. P.; Renwick, A.; Hessing, J. G.; Punt, P. J.; van den Hondel, C. A.; Read, N. D.
Corresponding AuthorN.D. Read
Corresponding AddressFungal Cell Biology Group, Institute of Cell and Molecular Biology, University of Edinburgh, Rutherford Building, Edinburgh EH9 3JH, UK.
Publication Year2004
Publication TitleCalcium measurement in living filamentous fungi expressing codon-optimized aequorin
AbstractCalcium signalling is little understood in filamentous fungi largely because easy and routine methods for calcium measurement in living hyphae have previously been unavailable. We have developed the recombinant aequorin method for this purpose. High levels of aequorin expression were obtained in Neurospora crassa, Aspergillus niger and Aspergillus awamori by codon optimization of the aequorin gene. Three external stimuli (mechanical perturbation, hypo-osmotic shock and high external calcium) were found transiently to increase [Ca(2+)](c). Each of the calcium signatures associated with these physico-chemical treatments was unique, suggesting the involvement of three distinct calcium-mediated signal transduction pathways. The fungal calcium channel blocker KP4 inhibited the [Ca(2+)](c) responses to hypo-osmotic shock and high external calcium, but not to mechanical perturbation. The divalent cation chelator BAPTA inhibited [Ca(2+)](c) responses to mechanical perturbation and hypo-osmotic shock. The calcium agonists A23187 and cyclopiazonic acid increased [Ca(2+)](c) levels.
JournalMol Microbiol. 52(5): 1437-50.
SummaryNeurospora crassa, Aspergillus niger, and Aspergillus awamori were transformed with a recoded version of the aeqD gene, aeqS, in order to increase the expression of aequorin protein in these organisms. Codons of aeqD were modified in order to fit the codon usage patterns of Neurospora crassa, Aspergillus niger, and Aspergillus awamori in order to aquire aeqD. aeqD yielded very high increases of aequorin in all three fungi. Overall, the recoding was very successful in providing more expression of protein.
CommentsNo accession number or GI given for recoded gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=530
PubMed ID15165245
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site