Synthetic Gene DataBase
 

Synthetic Gene 121


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID112121
GenBank AccessionNM_000579
GenBank GI4502638
Gene NameCCR5synCCR5
Gene Length (bp)10591089
SpeciesHomo sapiens (human)Homo sapiens, Monkey, Mus musculus
StrainsCf2Th, HEK-293T, COS-1, Hela
CDSatggattatcaagtgtcaagtccaatctatgacatcaattattatacatcggagccctgc
caaaaaatcaatgtgaagcaaatcgcagcccgcctcctgcctccgctctactcactggtg
ttcatctttggttttgtgggcaacatgctggtcatcctcatcctgataaactgcaaaagg
ctgaagagcatgactgacatctacctgctcaacctggccatctctgacctgtttttcctt
cttactgtccccttctgggctcactatgctgccgcccagtgggactttggaaatacaatg
tgtcaactcttgacagggctctattttataggcttcttctctggaatcttcttcatcatc
ctcctgacaatcgataggtacctggctgtcgtccatgctgtgtttgctttaaaagccagg
acggtcacctttggggtggtgacaagtgtgatcacttgggtggtggctgtgtttgcgtct
ctcccaggaatcatctttaccagatctcaaaaagaaggtcttcattacacctgcagctct
cattttccatacagtcagtatcaattctggaagaatttccagacattaaagatagtcatc
ttggggctggtcctgccgctgcttgtcatggtcatctgctactcgggaatcctaaaaact
ctgcttcggtgtcgaaatgagaagaagaggcacagggctgtgaggcttatcttcaccatc
atgattgtttattttctcttctgggctccctacaacattgtccttctcctgaacaccttc
caggaattctttggcctgaataattgcagtagctctaacaggttggaccaagctatgcag
gtgacagagactcttgggatgacgcactgctgcatcaaccccatcatctatgcctttgtc
ggggagaagttcagaaactacctcttagtcttcttccaaaagcacattgccaaacgcttc
tgcaaatgctgttctattttccagcaagaggctcccgagcgagcaagctcagtttacacc
cgatccactggggagcaggaaatatctgtgggcttgtga
atggactaccaggtgtcctcccccatctacgacatcaactactacacctccgagccctgc
cagaagatcaacgtgaagcagatcgccgcccgcctgctgccccccctgtactccctggtg
ttcatcttcggcttcgtgggcaacatgctggtgatcctgatcctgatcaactgcaagcgc
ctgaagtccatgaccgacatctacctgctgaacctggccatctccgacctgttcttcctg
ctgaccgtgcccttctgggcccactacgccgccgcccagtgggacttcggcaacaccatg
tgccagctgctgaccggcctgtacttcatcggcttcttctccggcatcttcttcatcatc
ctgctgaccatcgaccgctacctggccgtggtgcacgccgtgttcgccctgaaggcccgc
accgtgaccttcggcgtggtgacctccgtgatcacctgggtggtggccgtgttcgcctcc
ctgcccggcatcatcttcacccgctcccagaaggagggcctgcactacacctgctcctcc
cacttcccctactcccagtaccagttctggaagaacttccagaccctgaagatcgtgatc
ctgggcctggtgctgcccctgctggtgatggtgatctgctactccggcatcctgaagacc
ctgctgcgctgccgcaacgagaagaagcgccaccgcgccgtgcgcctgatcttcaccatc
atgatcgtgtacttcctgttctgggccccctacaacatcgtgctgctgctgaacaccttc
caggagttcttcggcctgaacaactgctcctcctccaaccgcctggaccaggccatgcag
gtgaccgagaccctgggcatgacccactgctgcatcaaccccatcatctacgccttcgtg
ggcgagaagttccgcaactacctgctggtgttcttccagaagcacatcgccaagcgcttc
tgcaagtgctgctccatcttccagcaggaggcccccgagcgcgcctcctccgtgtacacc
cgctccaccggcgagcaggagatctccgtgggcctgggcaccgagacctcccaggtggcc
cccgcctaa
5' End
3' End
Notes
Expression VectorpcDNA 3.1, PACH, PND, PMT4, and pcDNA4/HisMaxpcDNA 3.1, PACH, PND, PMT4, and pcDNA4/HisMax
Assay MethodsFACS, pulse-chase analysis, Western BlotFACS, pulse-chase analysis, Western Blot
ResultsLowIncrease.
Protein Functionco-receptor for macrophage-tropic virus, including HIV, to enter host cells.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe sequence encoding human CCR5 was optimized for mammalian cell codon usage, utilizing the
following codons: A (GCC), R (CGC), N (AAC), D (GAC), C (TGC), E (GAG), Q (CAG), G (GGC), H (CAC), I
(ATC), L (CTG), K (AAG), M (ATG), F (TTC), P (CCC), S (TCC), T (ACC), W (TGG), Y (TAC), and V (GTG).
The 5' and 3' sequences flanking the CCR5 coding sequence were modified. Following restriction sites
for EcoRV, EcoRI and HindIII, the Kozak consensus (GCCGCCACCATGG) was placed immediately 5' to the
CCR5 reading frame. A sequence encoding a single glycine residue followed by the bovine rhodopsin C9
peptide tag (TETSQVAPA) was introduced immediately 5' to the natural stop codon of CCR5. At the 3'
end of the epitope-tagged CCR5 gene, XbaI, SalI, and NotI restriction sites were introduced.
Publication Author(s)Mirzabekov, T.; Bannert, N.; Farzan, M.; Hofmann, W.; Kolchinsky, P.; Wu, L.; Wyatt, R.; Sodroski, J.
Corresponding AuthorDr.Joseph Sodroski
Corresponding AddressDepartment of Cancer Immunology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA.
Publication Year1999
Publication TitleEnhanced expression, native purification, and characterization of CCR5, a principal HIV-1 coreceptor
AbstractSeven-transmembrane segment, G protein-coupled receptors (GPCRs) play important roles in many biological processes in which pharmaceutical intervention may be useful. High level expression and native purification of GPCRs are important steps in the biochemical and structural characterization of these molecules. Here, we describe enhanced mammalian cell expression and purification of a codon-optimized variant of the chemokine receptor CCR5, a GPCR that plays a central role in the entry of the human immunodeficiency virus-1 (HIV-1) into immune cells. CCR5 could be solubilized in its native state as determined by its ability to be precipitated by 2D7, a conformation-dependent anti-CCR5 antibody, and by the HIV-1 gp120 envelope glycoprotein. The 2D7 antibody recognized immature and mature forms of CCR5 equally, whereas gp120 preferentially recognized the mature form, a result that underscores a role for posttranslational modification of CCR5 in its HIV-1 coreceptor function. The methods described herein contribute to the analysis of CCR5 and are likely to be applicable to many other GPCRs.
JournalJ Biol Chem. 274(40): 28745-50.
SummaryTo enhance mammalian cell expression and purification, codon-optimized variant of the chemokine receptor CCR5, a GPCR that plays a central role in the entry of the HIV-1 into immune cells, was constructed. The sequence encoding human CCR5 was optimized for mammalian cell codon usage, utilizing the following codons: A (GCC), R (CGC), N (AAC), D (GAC), C (TGC), E (GAG), Q (CAG), G (GGC), H (CAC), I (ATC), L (CTG), K (AAG), M (ATG), F (TTC), P (CCC), S (TCC), T (ACC), W (TGG), Y (TAC), and V (GTG). The 5' and 3' sequences flanking the CCR5 coding sequence were modified. Following restriction sites for EcoRV, EcoRI and HindIII, the Kozak consensus (GCCGCCACCATGG) was placed immediately 5' to the CCR5 reading frame. A sequence encoding a single glycine residue followed by the bovine rhodopsin C9 peptide tag (TETSQVAPA) was introduced immediately 5' to the natural stop codon of CCR5. At the 3' end of the epitope-tagged CCR5 gene, XbaI, SalI, and NotI restriction sites were introduced. The wild type and the synthetic genes were transiently expressed in several different cell lines, using five different expression vectors (pcDNA 3.1, PACH, PND, PMT4, and pcDNA4/HisMax). The level of CCR5 expression directed by the codon-optimized gene was 2-5 times that directed by the wild-type CCR5 gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=665
PubMed ID10497246
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site