Synthetic Gene DataBase
 

Synthetic Gene 122


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID113122
GenBank AccessionAY373583
GenBank GI34595585
Gene NameVP1recombinant VP1-hCTB
Gene Length (bp)639558
SpeciesFoot-and-mouth disease virus (FMDV)Hansenula polymorpha
StrainsType O
CDSaccacctctgcgggtgagtctgcggaccccgtgactgccaccgttgagaactacggtggt
gagacacaagcccagaggcgccagcacacggacattacgttcatactggacaggttcgtg
aaagtcaagccaaaggaacaagttaatgtgttggacctgatgcagatccccgcccacacc
ttggtaggggcgctcctgcgaacggccacctactacttctctgacttggaactggctgtc
aagcacgagggcgatctcacctgggtcccaaacggcgcccctgagacagcactggacaac
actaccaacccaacagcttaccacaaggaaccactcacacggctggcactgccttacacg
gctccacaccgcgtcttagcgaccgtctacaacgggagcagtaagtacggtgacaccagc
actaacaacgtgagaggtgacctccaagtattggctcagaaggcagaaagaactctgcct
acctccttcaacttcggtgccattaaggcaactcgtgtgactgaactactctacagaatg
aagagagccgagacgtactgccccaggccccttctcgccattcaaccgagtgacgccaga
cacaagcagaagattgtggcacccgcaaaacagcttctg
atggagacccaagtccaaagaagacaacacaccgacatcgctttcatcttggacagattc
gtcggtggttccggtggtaagtacggtgacacctccaccaacaacgtcagaggtgacttg
caagtcttggctcaaaaggctgagagaaccttgccaggtggttccggtggtagacacaag
caaagaatcgtcgctccagctaagcaattgttgggtggttccggtggtaccccacaaaac
atcaccgacttgtgtgctgagtaccacaacacccaaatctacaccttgaacgacaagatc
ttctcctacaccgagtccttggctggtaagagagagatggctatcatcaccttcaagaac
ggtgctatcttccaagtcgaggtcccaggttcccaacacatcgactcccaaaagaaggct
atcgagagaatgaaggacaccttgagaatcgcttacttgaccgaggctaaggtcgagaag
ttgtgtgtctggaacaacaagaccccacacgctatcgctgctatctctatggctaaccac
caccaccaccaccactag
5' End
3' End
NotesNatural gene was taken from NCBI database based on description ,number of amino acids and results of recoded gene search, gene is also given as an incomplete gene.No accession number or GI given for recoded gene.
Expression VectorpHFMDZ-alpha-A
Assay MethodsWestern Blot, ELISA
ResultsSignificant increase (100mg/L)
Protein FunctionCapsid protein of FMDV
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodFusion of CTB gene and FMDV VP1 gene. Codons were modified based on the codon usage preferred by
Hansenula polymorpha.
Publication Author(s)Song, H.; Zhou, L.; Fang, W.; Li, Y.; Wang, X.; Fang, H.; Li, X.; Wu, M.; Qiu, B.
Corresponding AuthorBingsheng Qiu
Corresponding AddressMolecular Microbiological Centre, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, PR China.
Publication Year2004
Publication TitleHigh-level expression of codon optimized foot-and-mouth disease virus complex epitopes and cholera toxin B subunit chimera in Hansenula polymorpha
AbstractA codon optimized DNA sequence coding for foot-and-mouth disease virus (FMDV) capsid protein complex epitopes of VP1 amino acid residues 21-40, 135-160, and 200-213 was genetically fused to the N-terminal end of a 6x His-tagged cholera toxin B subunit (CTB) gene with the similar synonymous codons preferred by the methylotropic yeast Hansenula polymorpha. The fusion gene was synthesized based on a polymerase chain reaction (PCR) and subsequently overexpressed in H. polymorpha. The chimeric protein was successfully secreted into the culture medium (up to 100mg/L) and retained the antigenicity associated with CTB and FMDV antibodies by Western blot analysis. The chimera after purification through Co(2+)-charged resin column bound specifically to GM1 ganglioside receptor and thus retained the biological activity of CTB. This study has important implications in the construction of CTB chimera for mucosal vaccines against FMDV.
JournalBiochem Biophys Res Commun. 315(1): 235-9.
SummaryMethyltrophic yeast (Hansenula polymorpha) was transformed with recombinant VP1-hCTB, a recoded version of the VP1-hCTB gene, in order to increase the expression of a protein, FMDV VP1 capsid protein. The VP1-hCTB gene had its codons modified based on the codon usage patterns of Methyltrophic yeast to attain recombinant VP1-hCTB. Recombinant VP1-hCTB yielded a significant amount of protein, enough to deem the recoding successful.
CommentsNatural gene was taken from NCBI database based on description ,number of amino acids and results of recoded gene search, gene is also given as an incomplete gene. No accession number or GI given for recoded gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=550
PubMed ID15013451
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site