Synthetic Gene DataBase
 

Synthetic Gene 123


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID114123
GenBank AccessionX60771
GenBank GI2307
Gene Nameafpsynthetic afp
Gene Length (bp)2850
SpeciesAspergillus giganteusOryza sativa
StrainsLeaves
CDSatgaagttcgtttctctcgcttctttgggattcgccctcgttgctgcccttggcgcggtt
gccacccccgttgaagccgattctctcaccgctggtggtctggatgcaagagatgagagc
gcggttttggccacatacaatggcaaatgctacaagaaggataatatctgcaagtacaag
gcacagagcggcaagactgccatttgcaagtgctatgtcaaaaagtgcccccgcgacggc
gcgaaatgcgagtttgacagctacaaggggaagtgctactgctag
5' End
3' End
NotesCDS for wild type gene taken from NCBI and chosen using references in article.Corresponding author was contacted for CDS of recoded gene on 1-14-2006.
Expression VectorpCAMBIA 1300pCAMBIA 1300
Assay MethodsSDS-PAGE, Southern Blot, Northern BlotSDS-PAGE, Southern Blot, Northern Blot
ResultsSignificant amountSlightly higher increase
Protein Functionantifungal protein which acts against filamentous fungi
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Method
Publication Author(s)Coca, M.; Bortolotti, C.; Rufat, M.; Penas, G.; Eritja, R.; Tharreau, D.; del Pozo, A. M.; Messeguer, J.; San Segundo, B.
Corresponding AuthorBlanca San Segundo
Corresponding AddressDepartamento de Genetica Molecular, Instituto de Biologia Molecular de Barcelona, CID-CSIC, Jordi Girona 18, 08034 Barcelona, Spain.
Publication Year2004
Publication TitleTransgenic rice plants expressing the antifungal AFP protein from Aspergillus giganteus show enhanced resistance to the rice blast fungus Magnaporthe grisea
AbstractThe Aspergillus giganteus antifungal protein (AFP), encoded by the afp gene, has been reported to possess in vitro antifungal activity against various economically important fungal pathogens, including the rice blast fungus Magnaporthe grisea. In this study, transgenic rice ( Oryza sativa ) constitutively expressing the afp gene was generated by Agrobacterium -mediated transformation. Two different DNA constructs containing either the afp cDNA sequence from Aspergillus or a chemically synthesized codon-optimized afp gene were introduced into rice plants. In both cases, the DNA region encoding the signal sequence from the tobacco AP24 gene was N-terminally fused to the coding sequence of the mature AFP protein. Transgenic rice plants showed stable integration and inheritance of the transgene. No effect on plant morphology was observed in the afp -expressing rice lines. The inhibitory activity of protein extracts prepared from leaves of afp plants on the in vitro growth of M. grisea indicated that the AFP protein produced by the trangenic rice plants was biologically active. Several of the T(2) homozygous afp lines were challenged with M. grisea in a detached leaf infection assay. Transformants exhibited resistance to rice blast at various levels. Altogether, the results presented here indicate that AFP can be functionally expressed in rice plants for protection against the rice blast fungus M. grisea.
JournalPlant Mol Biol. 54(2): 245-59.
SummaryRice (Oryza sativa) was transformed with a recoded version of the afp gene in order to increase protein expression in rice. afp had its codons modified based on the preferred codon usage of rice in order to construct the recoded gene, synthetic afp. Synthetic afp had a slightly higher increase in antifungal protein than the natural afp gene transformed rice. Overall, synthetic afp was successful in increasing protein expression, but not by much.
CommentsCDS for wild type gene taken from NCBI and chosen using references in article. Corresponding author was contacted for CDS of recoded gene on 1-14-2006, but no reply was received after 2 weeks.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=558
PubMed ID15159626
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site