Synthetic Gene DataBase
 

Synthetic Gene 124


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID98124
GenBank AccessionNM_026114
GenBank GI13385623
Gene NameeIF2AeIF2
Gene Length (bp)1704948
SpeciesHomo sapiensEscherichia coli
StrainsBL21 Star (DE3)
CDSagggcaattgggtacgggcccccccccggaagcgcacgctgaggagcttcggcgtccggg
gttggtgttccgagtctcctcgttgccactaagcagcacggcgtgggaccctacttcggg
attcacacatccacttcagaatgccggggctaagttgtagattttatcaacacaaatttc
ctgaggtggaagatgtagtgatggtgaatgtaagatccattgctgaaatgggggcctatg
tcagcttgttggaatataataacattgaaggcatgattcttcttagtgaattatcgagac
gacgtatccgttctataaacaaactgatccgaattggcagaaatgaatgtgttgttgtca
ttagagtggataaagaaaaaggatatatagatttgtcaaaaagaagagtttctccagagg
aagcaatcaaatgtgaggacaaattcacaaaatccaaaactgtttatagcattcttcgcc
atgttgctgaggtattagaatataccaaggatgagcagctggagagcctgttccagagga
ctgcctgggtcttcgatgacaagtacaagagacctggatacggtgcctacgatgctttta
agcatgcagtctcagacccatctatcttggatagtttagatttgaatgaagatgaaagag
aagtactcattaataatatcaataggcgtttgaccccacaagcggtcaaaattcgagcag
atattgaagtagcttgctatggttatgaaggcattgatgctgtaaaagaagccctgaggg
caggtttgaattgttctacagaaaccatgcccatcaagattaatctaatagctccaccca
ggtatgtgatgacaacaacgaccctggagaggacagaaggcctgtctgtcctcaatcagg
ctatggcagttatcaaagagaagatcgaggagaagaggggcgtcttcaatgttcagatgg
agcccaaagtggtcacagatacagatgagactgaacttgcaaggcagctggaacggctgg
agagagaaaatgcagaagtggatggagatgatgatgcagaagaaatggaagccaaagctg
aagattaacgttttggcaaacagtccaatttaaggagtacgaagcagcccttcctggctg
tcaaccctagacttgagagttttccagtattgaaaacttcaaagctgaatatttttattt
ccaagtatttaagtattcaacaagccagaatctaaatgccctccttcatgtcagctgttt
ccacatagtggctctaacacctcaagcatttttcaagggagtggcttgatttgaccagag
acaaatcttaaacagcagtcctaatattgggcctacagtttccatttctcatgtctctgg
aatggcacccttatggttcagagatttaccagggactccaaacacaaacaatcccaatct
ttctatataaaatgtattcaagcaaacatcaaataaatttctgggatatttaattgtagg
cttcttccttcttgtcacaagttaaagccaatctgaatgctcagatcctaattatcttca
tatggtagaactcaatgggcaagtaactaaatgacttatgcaggaacagactctccaaag
gaatgttagagaagaaattaggaatttgacccctggtagagaaaaaccttgaaatcaatt
aaagatttatgtgcctgttaactc
atgccgggtctgtcttgccgtttctaccagcacaaattcccggaagttgaagacgttgtt
atggttaacgttcgttctatcgctgaaatgggtgcttacgtttctctgctggaatacaac
aacatcgaaggtatgatcctgctgtctgaactgtctcgtcgtcgtatccgttctatcaac
aaactgatccgtatcggtcgtaacgaatgcgttgttgttatccgtgttgacaaagaaaaa
ggttacatcgacctgtctaaacgtcgtgtttctccggaagaagctatcaaatgcgaagac
aaattcaccaaatctaaaaccgtttactctatcctgcgtcacgttgctgaagttctggaa
tacaccaaagacgaacagctggaatctctgttccagcgtaccgcttgggttttcgacgac
aaatacaaacgtccgggttacggtgcttacgacgctttcaaacacgctgtttctgacccg
tctatcctggactctctggacctgaacgaagacgaacgtgaagttctgatcaacaacatc
aaccgtcgtctgaccccgcaggctgttaaaatccgtgctgacatcgaagttgcttgctac
ggttacgaaggtatcgacgctgttaaagaagctctgcgtgctggtctgaactgctctacc
gaaaacatgccgatcaaaatcaacctgatcgctccgccgcgttacgttatgaccaccacc
accctggaacgtaccgaaggtctgtctgttctgtctcaggctatggctgttatcaaagaa
aaaatcgaagaaaaacgtggtgttttcaacgttcagatggaaccgaaagttgttaccgac
accgacgaaaccgaactggctcgtcagatggaacgtctggaacgtgaaaacgctgaagtt
gacggtgacgacgacgctgaagaaatggaagctaaagctgaagactaa
5' End
3' End
Notes
Expression VectoreIF2alpha-opt
Assay MethodsNMR spectroscopy
ResultsThe natural gene was not expressed in this experiment. However, from prior studies, the natural gene has been shown to be poorly expressed in E. coli.The recoded gene produced an NMR sample of 0.5-0.7 mM concentration, in contrast to wild-type protein that is soluble only up to 0.05 mM.
Protein FunctionCatalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits in humans
Recoding PurposeTo improve solubility for NMR spectroscopy
Synthesized ByIto and Wagner
Recoding MethodOptimization of codons was based on previous reports of E. coli codo usage, as follows: GCT for Ala,
CGT for Arg, AAC for Asn, GAC for Asp, TGC for Cys, CAG for Gln, GAA for Glu, GGT for Gly, CAG for
His, ATC for Ile, CTG for Leu, AAA for Lys, ATG for Met, TTC for Phe, CCG for Pro, TCT for Ser, ACC
for Thr, TGG for Trp, and GTT for Val.
Publication Author(s)Ito, T.; Wagner, G.
Corresponding AuthorGerhard Wagner
Corresponding AddressDepartment of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115, USA.
Publication Year2004
Publication TitleUsing codon optimization, chaperone co-expression, and rational mutagenesis for production and NMR assignments of human eIF2 alpha
AbstractProducing a well behaved sample at high concentration is one of the main hurdles when starting a new project on an interesting protein. Especially when one attempts to overexpress a eukaryotic protein in bacteria, some difficulties are encountered, such as low expression level, low solubility, or even lack of folded structure. Overexpression in prokaryotic systems is highly desirable for cost-effective production of different isotope-labeled samples needed for NMR studies. Here we describe generally applicable methods for obtaining highly concentrated protein samples efficiently. This approach was developed as we tried to produce a NMR-suitable sample of the 35 kDa human translation initiation factor eIF2 alpha, a protein that expresses poorly in E. coli and has very low solubility. First, an E. coli codon-optimized gene was synthesized on a thermal cycler, which increased the expression level by a factor of two. Second, we used co-expression of bacterial chaperone proteins, which largely increased the fraction of correctly folded protein found in the soluble phase. Third, we used rational mutagenesis guided by both the sequence alignment among homologues and the homology of one domain to a known fold for improving solubility and stability of the target protein by tenfold. Combining all these methods made it possible to produce from a one-liter preparation a 0.5 mM sample of human eIF2 alpha that showed well-resolved NMR spectra and enabled nearly complete assignment of the protein. These methods may be generally useful for studies of other eukaryotic proteins that are otherwise difficult to express and exhibit poor solubility.
JournalJ Biomol NMR. 28(4): 357-67.
SummaryThe goal of this experiment was to optimize the eIF2alpha protein of humans for NMR spectroscopy, so as to better determine its structure. When optimized for expression in E. coli, the protein was expressed at a much higher concentration, allowing NMR spectroscopy studies to be performed on it. The gene was optimized using data from past studies. The exact codon replacements are explained in the section of Materials and Methods labeled "Synthesis of codon-optimized gene".
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=656#656
PubMed ID14872127
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site