Synthetic Gene DataBase
 

Synthetic Gene 125


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID116125
GenBank AccessionAX111726U50963
GenBank GI139279781289497
Gene NameGFP (synthetic)hRGFP (partially humanized, red-shifted)
Gene Length (bp)716717
SpeciesAequorea victoriaHomo sapiens; Mus musculus
StrainsA375 (melanoma cells); PA317 (fibroblast cells)
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaata
atgagcaagggcgaggaactgttcactggcgtggtcccaattctcgtggaactggatggc
gatgtgaatgggcacaaattttctgtcagcggagagggtgaaggtgatgccacatacgga
aagctcaccctgaaattcatctgcaccactggaaagctccctgtgccatggccaacactg
gtcactaccttctcttatggcgtgcagtgcttttccagatacccagaccatatgaagcag
catgactttttcaagagcgccatgcccgagggctatgtgcaggagagaaccatctttttc
aaagatgacgggaactacaagacccgcgctgaagtcaagttcgaaggtgacaccctggtg
aatagaatcgagctgaagggcattgactttaaggaggatggaaacattctcggccacaag
ctggaatacaactataactcccacaatgtgtacatcatggccgacaagcaaaagaatggc
atcaaggtcaacttcaagatcagacacaacattgaggatggatccgtgcagctggccgac
cattatcaacagaacactccaatcggcgacggccctgtgctcctcccagacaaccattac
ctgtccacccagtctgccctgtctaaagatcccaacgaaaagagagaccacatggtcctg
ctggagtttgtgaccgctgctgggatcacacatggcatggacgagctgtacaagtga
5' Endggatctagaggatccgcggccgcctagttattaatagtaatcaattacggggtcggatctagaggatccgcggccgcctagttattaatagtaatcaattacggggtc
3' Endtacaagtccggactcagatctcgagctcaataatgatagaagctttcctacaagtccggactcagatctcgagctcaataatgatagaagctttcc
NotesWild-type sequence is an isotype of GFP submitted by Heim et. Al, referenced by the authors of this paper.
Expression VectorpLNCGpLNChRG
Assay Methodsfluorescence microscopy, FACSfluorescence microscopy, FACS
Results<2% of cell population exhibited fluorescence after 48 hours. Stably transduced cells with only 1 copy of wild-type GFP gene never produce visible fluorescence.30% to 40% of cell population exhibited fluorescence after 36 hours. 100% exhibited bright fluorescence after G418 selection. Stably transduced cells with only 1 copy of hRGFP gene can produce fluorescence.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodNot described.
Publication Author(s)Levy JP, Muldoon RR, Zolotukhin S, Link CJ Jr.
Corresponding AuthorCharles J. Link Jr.
Corresponding AddressGene Therapy Program, HGTRI, Des Moines, IA 50309, USA.
Publication Year1996
Publication TitleRetroviral transfer and expression of a humanized, red-shifted green fluorescent protein gene into human tumor cells
AbstractOver two-thirds of the current gene therapy protocols use retroviral gene transfer systems. We have developed an efficient retroviral-based method that allows rapid identification of gene transfer in living mammalian cells. Cells were generated containing a gene for an improved (humanized, red-shifted) version of the Aequorea victoria green fluorescent protein (hRGFP) from a retroviral vector. The hRGFP gene was used to produce an amphotropic vector producer cell line that demonstrated vibrant green fluorescence after excitation with blue light. A375 melanoma cells transduced with the retroviral vector demonstrated stable green fluorescence. Both PA317 murine fibroblasts and A375 human cell lines containing the vector were easily detected by FACS analysis. These vectors represent a substantial improvement over currently available gene transfer marking systems. Bright, long-term expression of the hRGFP gene in living eukaryotic cells will advance the study of gene transfer, gene expression, and gene product function in vitro and in vivo particularly for human gene therapy applications.
JournalNat Biotechnol. 14(5): 610-4.
SummaryThe authors sought to attach GFP to retroviral gene transfer systems in order to quickly determine if gene transfer successfully occurred in living mammalian organisms. In order to have an effective method, the GFP fusion would have to be highly sensitive. Initial evaluation of wild-type GFP from Aequorea Victoria showed very little fluorescence in transient transfection and absolutely no fluorescence under stable transfection. To improve fluorescence, the authors used the suggestions from a previous experiment by Heim et. Al and changed serine-65 to threonine, moving the mutated protein’s absorption peak to 490 nm from 450-490 nm and drastically increasing fluorescence intensity. The authors also recoded the coding sequence to make it partially humanized increasing the percentage of cells that were able to express it from <2% to 30-40%. The authors claim no cytopathic effects nor growth inhibition occurred due to GFP transfection/transduction, summing up that this recoding produced an effective means of tracking retroviral gene transfer.
CommentsThere was no GFP without recoding control group. You cannot tell for sure whether the S65T change, the recoding of the sequence, or both was responsible for the increase in gene expression. However, it is most likely that the recoding was responsible, and the problem is addressed in a later paper by the same authors (See Muldoon 1997).
Discussion
PubMed ID9630952
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site