Synthetic Gene DataBase
 

Synthetic Gene 126


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID117126
GenBank AccessionAF156179AY166597
GenBank GI669052327414110
Gene NameEIEIM
Gene Length (bp)696696
SpeciesActinia equinaPichia pastoris
StrainsGS115
CDSatggctcttagccaaaaccaagccaagttttccaaaggattcgtcgtgatgatttgggta
ctattcattgcttgtgctataacttcaactgaagctagtctaaccaaatgccaacagctc
caggcctcggctaacagtggtctgataggtgcttatgtaccacaatgcaaagaaacggga
gagttcgaagaaaaacaatgctggggatcgactggttactgttggtgtgtggatgaagat
ggaaaagagattctaggaaccaagatccgtggatctccggattgcagccgcagaaaagcc
gcgttaacactttgccagatgatgcaagccatcattgttaatgtccctggttggtgtggc
cctccatcgtgtaaagctgacggcagttttgacgaggttcagtgctgcgcaagtaatgga
gaatgctactgtgtggataagaaaggaaaagaacttgaaggcacaagacaacagggaagg
ccaacctgcgaaagacacctaagcgaatgcgaggaagctcgaatcaaggcgcattcaaac
agtcttcgtgttgagatgttcgtgccagagtgttttgaagatggatcatataacccagta
cagtgctggcctagcacaggatactgttggtgcgtcgatgaaggaggggtaaaggtacca
ggttccgatgtcagatttaaacgccccacatgctaa
atggctcttagccagaaccaggccaagttttccaagggattcgtcgtgatgatttgggta
ctattcattgcttgtgctatcacttcaactgaagctagtctaacgaaatgccaacagctg
caggcctcggctaacagtggtctgataggtacttatgtaccacaatgcaaagaaactgga
gagtttgaagaaaagcaatgctggggatcgactggttactgttggtgtgtggatgaagat
ggaaaagagattctaggtacaaagatccgtggatctccagactgcagtcgcagaaaagct
gccttaacactttgccagatgatgcaagccatcattgtgaatgtccctggttggtgtgga
cctccatcatgtaaagctgacggcagttttgacgaggttcagtgctgcgcaagtaatgga
gaatgctactgtgtggataagaaaggaaaagaacttgaaggcacaagacaacagggaagg
ccaacctgcgaaagacacctaagcgaatgcgaggaggctcgtatcaaggcacattcaaac
agtcttcgtgttgagatgttcgtgccagagtgtttagaagatggatcttacaaccctgta
cagtgctggcctagcacaggatactgttggtgcgtcgatgaaggaggggtaaaggttcca
ggttccgacgtcagattcaaacgtcccacatgctaa
5' End
3' End
NotesCDS of natural gene was found based on the references in the article.
Expression VectorpPIC9pPIC9
Assay MethodsSDS-PAGE, Western Blot, Bradford’s methodSDS-PAGE, Western Blot, Bradford’s method
ResultsSignificant amount (median: 9mg/L)Significant increase (2 fold more)
Protein FunctionInhibits cysteine and aspartic acid proteases
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons in natural gene were modified based on the preferred codon usage of yeast. This led to a
lower repetitive AT and GC content.
Publication Author(s)Outchkourov, N. S.; Stiekema, W. J.; Jongsma, M. A.
Corresponding AuthorMaarten A. Jongsma
Corresponding AddressBusiness Unit Cell Cybernetics, Plant Research International, Wageningen, The Netherlands.
Publication Year2002
Publication TitleOptimization of the expression of equistatin in Pichia pastoris
AbstractTo improve the expression of equistatin, a proteinase inhibitor from the sea anemone Actinia equina, in the yeast Pichia pastoris, we prepared gene variants with yeast-preferred codon usage and lower repetitive AT and GC content. The full gene optimization approximately doubled the level of steady-state mRNA and protein accumulated in the culture medium. The removal of a short stretch of 12 additional nucleotides from the multiple cloning site (MCS) sequence in the vector pPIC9 had an enhancement effect similar to full gene optimization (factor 1.5) at the mRNA level. However, at the protein level, this increase was 4- to 10-fold. The optimized gene without the MCS sequence yielded 1.66 g/L active protein in a bioreactor and was purified by a new two-step procedure with a recovery of activity that was >95%. This production level constitutes an overall improvement of about 20-fold relative to our previously published results. The characteristics of the MCS sequence element are discussed in the light of its apparent ability to act as negative expression regulator.
JournalProtein Expr Purif. 24(1): 18-24.
SummaryMitochondrial yeast (Pichia pastoris) was transformed with EIM, a recoded gene version of the EI gene, in order to increase protein expression. In order to acquire EIM, EI had was fully optimized with its codons modified based on the codon usage of Pichia pastoris. EIM transformed yeast had twice as much protein production as the natural gene, EI, transformed yeast. Though not a huge increase, the recoded gene can be successful since it increased protein expression.
CommentsCDS of natural gene was found based on the references in the article.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=537
PubMed ID11812218
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site