Synthetic Gene DataBase
 

Synthetic Gene 127


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID118127
GenBank AccessionK02640.1
GenBank GI168145
Gene NameFSoCutFSoCut
Gene Length (bp)789789
SpeciesFusarium solaniEscherichia coli
StrainsNot mentionedDHB4
CDSatgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaa
gccgcgcctacttctaaccctgcccaggagcttgaggcgcgccagcttggtagaacaact
cgcgacgatctgatcaacggcaatagcgcttcctgcgccgatgtcatcttcatttatgcc
cgaggttcaacagagacgggcaacttgggaactctcggtcctagcattgcctccaacctt
gagtccgccttcggcaaggacggtgtctggattcagggcgttggcggtgcctaccgagcc
actcttggagacaatgctctccctcgcggaacctgtagcgccgcaatcagggagatgctc
ggtctcttccagcaggccaacaccaagtgccctgacgcgactttgatcgccggtggctac
agccagggtgctgcacttgcagccgcctccatcgaggacctcgactcggccattcgtgac
aagatcgccggaactgttctgttcggctacaccaagaacctacagaaccgtggccgaatc
cccaactaccctgccgacaggaccaaggtcttctgcaatacaggggatctcgtttgtact
ggtagcttgatcgttgctgcacctcacttggcttatggtcctgatgctcgtggccctgcc
cctgagttcctcatcgagaaggttcgggctgtccgtggttctgctctcgagatcaaacgg
gctagccagccagaactcgccccggaagaccccgaggatgtcgagcaccaccaccaccac
cactgatga
atgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaa
gccgcgccgacctctaacccggcgcaggagctggaggcgcgtcagctgggtcgtaccacc
cgtgacgacctgatcaacggtaactctgcgtcttgcgcggacgttatcttcatctacgcg
cgtggttctaccgagaccggtaacctgggtaccctgggtccgtctatcgcgtctaacctg
gagtctgcgttcggtaaggacggtgtttggatccagggtgttggtggtgcgtaccgtgcg
accctgggtgacaacgcgctgccgcgtggtacctgttctgcggcgatccgtgagatgctg
ggtctgttccagcaggcgaacaccaagtgcccggacgcgaccctgatcgcgggtggttac
tctcagggtgcggcgctggcggcggcgtctatcgaggacctggactctgcgatccgtgac
aagatcgcgggtaccgttctgttcggttacaccaagaacctgcagaaccgtggtcgtatc
ccgaactacccggcggaccgtaccaaggttttctgcaacaccggtgacctggtttgcacc
ggttctctgatcgttgcggcgccgcacctggcgtacggtccggacgcgcgtggtccggcg
ccggagttcctgatcgagaaggttcgtgcggttcgtggttctgcgctcgagatcaaacgg
gctagccagccagaactcgccccggaagaccccgaggatgtcgagcaccaccaccaccac
cactgatga
5' End
3' End
Notes
Expression VectorpDrFSTpFSTR
Assay MethodsNorthern blotNorthern blot
ResultsThe natural gene, when expressed, produced a poor concentration of cutinase.The recoded gene produced a much higher concentration of cutinase mRNA than did the natural gene.
Protein FunctionCutinase is a small esterase which acts to degrade the exterior cutin of plants.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe gene was recoded so as to remove 18 codons which are used less than 5% in E. coli according to
A. Henaut et all's paper "Analysis and predictions from Escherichia coli sequences, or E. Coli in
silico". These low usage codons were replaced with more favorable codons.
Publication Author(s)Griswold, K. E.; Mahmood, N. A.; Iverson, B. L.; Georgiou, G.
Corresponding AuthorGeorge Georgiou
Corresponding AddressDepartment of Chemistry and Biochemistry, University of Texas, Austin, TX 78712, USA.
Publication Year2003
Publication TitleEffects of codon usage versus putative 5'-mRNA structure on the expression of Fusarium solani cutinase in the Escherichia coli cytoplasm
AbstractMatching the codon usage of recombinant genes to that of the expression host is a common strategy for increasing the expression of heterologous proteins in bacteria. However, while developing a cytoplasmic expression system for Fusarium solani cutinase in Escherichia coli, we found that altering codons to those preferred by E. coli led to significantly lower expression compared to the wild-type fungal gene, despite the presence of several rare E. coli codons in the fungal sequence. On the other hand, expression in the E. coli periplasm using a bacterial PhoA leader sequence resulted in high levels of expression for both the E. coli optimized and wild-type constructs. Sequence swapping experiments as well as calculations of predicted mRNA secondary structure provided support for the hypothesis that differential cytoplasmic expression of the E. coli optimized versus wild-type cutinase genes is due to differences in 5(') mRNA secondary structures. In particular, our results indicate that increased stability of 5(') mRNA secondary structures in the E. coli optimized transcript prevents efficient translation initiation in the absence of the phoA leader sequence. These results underscore the idea that potential 5(') mRNA secondary structures should be considered along with codon usage when designing a synthetic gene for high level expression in E. coli.
JournalProtein Expr Purif. 27(1): 134-42.
SummaryThe goal of this experiment was to optimize the Fusarium solani cutinase gene for expression in E. coli. The recoding method was not explained in the paper. The recoded gene produced a much higher concentration of cutinase mRNA than did the natural gene, as shown by Northern blot analysis.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=659#659
PubMed ID12509995
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site