Synthetic Gene DataBase
 

Synthetic Gene 128


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID100128
GenBank AccessionNM_000039.1
GenBank GI4557320
Gene NameapoA-IapoA-I
Gene Length (bp)897826
SpeciesHomo sapiensEscherichia coli
StrainsNot mentionedBL21
CDSatgaaagctgcggtgctgaccttggccgtgctcttcctgacggggagccaggctcggcat
ttctggcagcaagatgaacccccccagagcccctgggatcgagtgaaggacctggccact
gtgtacgtggatgtgctcaaagacagcggcagagactatgtgtcccagtttgaaggctcc
gccttgggaaaacagctaaacctaaagctccttgacaactgggacagcgtgacctccacc
ttcagcaagctgcgcgaacagctcggccctgtgacccaggagttctgggataacctggaa
aaggagacagagggcctgaggcaggagatgagcaaggatctggaggaggtgaaggccaag
gtgcagccctacctggacgacttccagaagaagtggcaggaggagatggagctctaccgc
cagaaggtggagccgctgcgcgcagagctccaagagggcgcgcgccagaagctgcacgag
ctgcaagagaagctgagcccactgggcgaggagatgcgcgaccgcgcgcgcgcccatgtg
gacgcgctgcgcacgcatctggccccctacagcgacgagctgcgccagcgcttggccgcg
cgccttgaggctctcaaggagaacggcggcgccagactggccgagtaccacgccaaggcc
accgagcatctgagcacgctcagcgagaaggccaagcccgcgctcgaggacctccgccaa
ggcctgctgcccgtgctggagagcttcaaggtcagcttcctgagcgctctcgaggagtac
actaagaagctcaacacccagtga
atgcatcaccatcaccatcacggcctggtgccgcgcggcagcatcgatgatccgccgcag
agtccatgggatcgcgtgaaggacctggccactgtgtacgtggatgtgctcaaagacagc
ggcagagactatgtgtctcagtttgaaggatccgccttgggcaaacaattgaaccttaag
ctgctggacaactgggacagcgtgacgtccaccttcagcaagctgcgcgaacagctcggc
cctgtgacccaggaattctgggataacctggaaaaggagacagagggcctgcgccaggag
atgagcaaggatctggaggaggtgaaggccaaggtgcagccgtacctggacgacttccag
aagaagtggcaggaggagatggagctctaccgccagaaggtggagccgctgcgcgcagag
ctgcaggagggcgcgcgccagaagctgcacgagctgcaagagaagctgagcccactgggc
gaggagatgcgcgaccgcgcgcgcgcccatgtcgacgcgctgcgcacgcatctggcgccg
tacagcgacgagctgcgccagcgcttagcggcgcgccttgaggctctcaaggagaacggc
ggggcccgcctggccgagtaccacgccaaggccaccgagcatctgagcacgctcagcgag
aaggccaagccggcgctcgaggacctgcgccaaggcctgctgccggtgctggagagcttc
aaggtcagcttcctgagcgctctggaagagtacactaagaagcttaacacccagtga
5' Endggtaccaaaagctggcat
3' Endtcagctctagaactagtagatctgcggccgc
NotesThe recoded gene sequence was procured directly from the corresponding author, not from the paper itself or a database.
Expression VectorpNFXexpNFXex
Assay MethodsBicinchoninic acid assaySDS-PAGE
ResultsThe natural gene was expressed at around 20 mg/L in E. coli.The recoded gene produced 80-120 mg/L protein concentration, compared to 20 mg/L concentration produced by the natural gene.
Protein FunctionStructural component of high density lipoprotein, activator of LC acyltransferase, and acceptor of cholesterol
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method is explained in tabular form in the body of the paper, under the heading
Results-Restriction endonuclease site design.
Publication Author(s)Ryan, R. O.; Forte, T. M.; Oda, M. N.
Corresponding AuthorMicheal Oda
Corresponding AddressLipid Biology in Health and Disease Research Group, Children's Hospital Oakland Research Institute, 5700 Martin Luther King Jr. Way, Oakland, CA 94609, USA.
Publication Year2003
Publication TitleOptimized bacterial expression of human apolipoprotein A-I
AbstractApolipoprotein A-I (apoA-I) serves critical functions in plasma lipoprotein metabolism as a structural component of high density lipoprotein, activator of lecithin:cholesterol acyltransferase, and acceptor of cellular cholesterol as part of the reverse cholesterol transport pathway. In an effort to facilitate structure:function studies of human apoA-I, we have optimized a plasmid vector for production of recombinant wild type (WT) and mutant apoA-I in bacteria. To facilitate mutagenesis studies, subcloning, and DNA manipulation, numerous silent mutations have been introduced into the apoA-I cDNA, generating 13 unique restriction endonuclease sites. The coding sequence for human apoA-I has been modified by the introduction of additional silent mutations that eliminate 18 separate codons that employ tRNAs that are of low or moderate abundance in Escherichia coli. Yields of recombinant apoA-I achieved using the optimized cDNA were 100+/-20 mg/L bacterial culture, more than fivefold greater than yields routinely obtained with the original cDNA. Site-directed mutagenesis of the apoA-I cDNA was performed to generate a Glu2Asp mutation in the N-terminal sequence of apoA-I. This modification, which creates an acid labile Asp-Pro peptide bond between amino acids 2 and 3, permits specific chemical cleavage of an N-terminal His-Tag fusion peptide used for rapid protein purification. The product protein's primary structure is identical to WT apoA-I in all other respects. Together, these changes in apoA-I cDNA and bacterial expression protocol significantly improve the yield of apoA-I protein without compromising the relative ease of purification.
JournalProtein Expr Purif. 27(1): 98-103.
SummaryThe purpose of this experiment was to optimize the apoA-I gene for expression in E. coli. The gene was optimized according to the data in Table 1 in the body of the paper. The optimized gene produced up to five times as much protein as the natural gene.
CommentsThe recoded gene sequence was procured directly from the corresponding author, and the natural gene sequence was procured from the NCBI GenBank database.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=653#653
PubMed ID12509990
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site