Synthetic Gene DataBase
 

Synthetic Gene 129


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID119129
GenBank AccessionAH001134
GenBank GI162855
Gene Namechychy1
Gene Length (bp)11460
SpeciesBos taurusAspergillus awamori
Strainslpr66
CDSatgaggtgtctcgtggtgctacttgctgtcttcgctctctcccagggcactgagatcacc
aggatccctctgtacaaaggcaagtctctgaggaaggcgctgaaggagcatgggcttctg
gaggacttcctgcagaaacagcagtatggcatcagcagcaagtactccggcttcggggag
gtggccagcgtgcccctgaccaactacctggatagtcagtactttgggaagatctacctc
gggaccccgccccaggagttcaccgtgctgtttgacactggctcctctgacttctgggta
ccctctatctactgcaagagcaatggctgcaaaaaccaccagcgcttcgacccgagaaag
tcgtccaccttccagaacctgggcaagcccctgtctatccactacgggacaggcagcatg
cagggcatcctgggctatgacaccgtcactgtctccaacattgtggacatccagcagaca
gtaggcctgagcacccaggagcccggggacgtcttcacctatgccgaattcgacgggatc
ctggggatggcctacccctcgctcgcctcagagtactcgatacccgtgtttgacaacatg
atgaacaggcacctggtggcccaagacctgttctcggtttacatggacaggaatggccag
gagagcatgctcacgctgggggccatcgacccgtcctactacacagggtccctgcactgg
gtgcccgtgacagtgcagcagtactggcagttcactgtggacagtgtcaccatcagcggt
gtggttgtggcctgtgagggtggctgtcaggccatcctggacacgggcacctccaagctg
gtcgggcccagcagcgacatcctcaacatccagcaggccattggagccacacagaaccag
tacggtgagtttgacatcgactgcgacaacctgagctacatgcccactgtggtctttgag
atcaatggcaaaatgtacccactgaccccctccgcctataccagccaggaccagggcttc
tgtaccagtggcttccagagtgaaaatcattcccagaaatggatcctgggggatgttttc
atccgagagtattacagcgtctttgacagggccaacaacctcgtggggctggccaaagcc
atctga
5' End
3' End
NotesNatural gene taken from NBCI database based on references, no tests with natural gene.3 contructs were made total from transformation. pGHhyC which has a pepB promoter fused to the chy1 gene, pPChyP which has pepB promoter, and pPChyP which has the chymosin sequence without a pre-region. No recoded gene accession number or CDS provided, corresponding author was e-mailed on 1-17-2005.
Expression VectorpJL43b1
Assay MethodsWestern Blot, SDS-PAGE
ResultsSignificant increase (ranging from 0.9mg/L to 5.5mg/L in all contructs, protein also was formed as mature form)
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons from the natural gene were modified for optimal codon usage in Aspergillus awamori.
Publication Author(s)Cardoza, R. E.; Gutierrez, S.; Ortega, N.; Colina, A.; Casqueiro, J.; Martin, J. F.
Corresponding AuthorJ.F. Martin
Corresponding AddressInstitute of Biotechnology of Leon (INBIOTEC), Science Park of Leon, Leon, Spain.
Publication Year2003
Publication TitleExpression of a synthetic copy of the bovine chymosin gene in Aspergillus awamori from constitutive and pH-regulated promoters and secretion using two different pre-pro sequences
AbstractA copy of the bovine chymosin gene (chy) with a codon usage optimized for its expression in Aspergillus awamori was constructed starting from synthetic oligonucleotides. To study the ability of this filamentous fungus to secrete bovine prochymosin, two plasmids were constructed in which the transcriptional, translational, and secretory control regions of the A. nidulans gpdA gene and pepB genes were coupled to either preprochymosin or prochymosin genes. Secretion of a protein enzymatically and immunologically indistinguishable from bovine chymosin was achieved in A. awamori transformants with each of these constructions. In all cases, the primary translation product (40.5 kDa) was self-processed to a mature chymosin polypeptide having a molecular weight of 35.6 kDa. Immunological assays indicated that most of the chymosin was secreted to the extracellular medium. Hybridization analysis of genomic DNA from chymosin transformants showed chromosomal integration of prochymosin sequences and, in some transformants, multiple copies of the expression cassettes were observed. Expression from the gpdA promoter was constitutive, whereas expression from the pepB promoter was strongly influenced by pH. A very high expression from the pepB promoter was observed during the growth phase. The A. awamori pepB gene terminator was more favorable for chymosin production than the S. cerevisiae CYC1 terminator.
JournalBiotechnol Bioeng. 83(3): 249-59.
SummaryAspergillus awamori. a fungus, was transformed with a recoded version of the chy gene, chy1, in order to increase expression of the chymosin protein. chy1 was codpn optimized based on the patterns of highly expressed genes in Aspergillus awamori. The chy1 gene constructs were successful in increasing overall protein expression ranging from little significant amounts to high increases. Overall, the recoded gene was a success since it was able to increase protein expression as expected.
Comments3 contructs were made total from transformation. pGHhyC which has a pepB promoter fused to the chy1 gene, pPChyP which has pepB promoter, and pPChyP which has the chymosin sequence without a pre-region. Natural gene taken from NBCI database based on references, no tests with natural gene. No recoded gene accession number or CDS provided, corresponding author was e-mailed on 1-17-2006, but no reply was received after 2 weeks.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=534
PubMed ID12783481
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site