Synthetic Gene DataBase
 

Synthetic Gene 130


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID120130
GenBank Accession
GenBank GI
Gene NameTat-1wtTat-1co
Gene Length (bp)219219
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
StrainsType 1293 cells, HLM-1 cells, mouse spleen cells
CDSatggagccagtagatcctaacctagagccctggaaccatccaggaagtcagcctagaact
gcttgcaacaactgttattgtaaacgctgtagctaccattgtctagtttgctttcagcaa
aaaggcttaggcatttcctatggcaggaagaagtggagacagcgacgaagagctcctcca
agtagtgaggatcatcaaaatcttatatcgaagcaatag
atggagccagtagatcctaacctggagccctggaaccaccctggcagccagcccaagacc
gcctgcaacaactgctactgcaagcactgcagctaccactgcctggtgtgcttccagccc
aagggcctgggcatcagctacggccggaagaagcggcgccagcgccggagcgctcctcca
agcagcgaggaccaccaaaatcttatatcaaagcagtag
5' End
3' End
NotesThe HIV-1 wildtype Tat sequence was from Kavita Lole's paper (Lole K S et al., 1999).The sequence was kindly provided by Dr. Lakshmi Ramakrishna, Dept. of Biochemistry, Indian Institute of Science, Bangalore 560 012 India
Expression Vectorp95IN21301pET28A
Assay MethodsWestern Blot, p24 ELISA, Cytotoxicity assay, ELISPOT assay, ELISAWestern Blot, p24 ELISA, Cytotoxicity assay, ELISPOT assay, ELISA
ResultsLowIncrease expression.
Protein FunctionImportant in viral infectivity and pathogenesis
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodA total of 29 codons are replaced with those optimally used in mammals.
Publication Author(s)Ramakrishna, L.; Anand, K. K.; Mohankumar, K. M.; Ranga, U.
Corresponding AuthorUdaykumar Ranga
Corresponding AddressMolecular Virology Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore, India.
Publication Year2004
Publication TitleCodon optimization of the tat antigen of human immunodeficiency virus type 1 generates strong immune responses in mice following genetic immunization
AbstractDNA vaccines have been successful in eliciting potent immune responses in mice. Their efficiency, however, is restricted in larger animals. One reason for the limited performance of the DNA vaccines is the lack of molecular strategies to enhance immune responses. Additionally, genes directly cloned from pathogenic organisms may not be efficiently translated in a heterologous host expression system as a consequence of codon bias. To evaluate the influence of codon optimization on the immune response, we elected to use the Tat antigens of human immunodeficiency virus type 1 (HIV-1) (subtype C) and HIV-2, as these viral antigens are poorly immunogenic in natural infection and in experimental immunization and they are functionally important in viral infectivity and pathogenesis. Substituting codons that are optimally used in the mammalian system, we synthetically assembled Tat genes and compared them with the wild-type counterparts in two different mouse strains. Codon-optimized Tat genes induced qualitatively and quantitatively superior immune responses as measured in a T-cell proliferation assay, enzyme-linked immunospot assay, and chromium release assay. Importantly, while the wild-type genes promoted a mixed Th1-Th2-type cytokine profile, the codon-optimized genes induced a predominantly Th1 profile. Using a pepscan strategy, we mapped an immunodominant T-helper epitope to the core and basic domains of HIV-1 Tat. We also identified cross-clade immune responses between HIV-1 subtype B and C Tat proteins mapped to this T-helper epitope. Developing molecular strategies to optimize the immunogenicity of DNA vaccines is critical for inducing strong immune responses, especially to antigens like Tat. Our identification of a highly conserved T-helper epitope in the first exon of HIV-1 Tat of subtype C and the demonstration of a cross-clade immune response between subtypes B and C are important for a more rational design of an HIV vaccine.
JournalJ Virol. 78(17): 9174-89.
SummaryTo evaluate the influence of codon optimization on the immune response, codon-optimized HIV-1 Tat (Tat-1co) and HIV-2 Tat (Tat-2co) were constructed. The AT–rich codons of the wild type genes were replaced with the synonymous GC-rich codons that corresponded to the most frequently used mammalian (human) codons. The plasmids expressing these genes were transfected into different mammalian cells (293 cells, HLM-1 cells , HOS-CD4-LTR-GFP). Results showed that the codon-optimized Tat genes expressed significantly higher than wild type genes and enhanced the immune responses.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=672
PubMed ID15308713
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site