Synthetic Gene DataBase
 

Synthetic Gene 132


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID122132
GenBank AccessionAJ844897
GenBank GI58333799
Gene NameTCEsynTCE
Gene Length (bp)15541554
SpeciesTribolium castaneumPichia pastoris
StrainsISOSMD1168
CDSatgtccaacccaattgttaccattgaagaaggcaaactcttgggcaaaatttctaccaac
atcaatggtgaagaattttgcagtttccaaggcgttccgtacgcccaacctcctattggg
catttgcgattcaaagcacctcaagcgccccaaccctggactggaattcgcgatgcccta
agtgagggaaataaatgctacagcaaggacctacttttcaatctcccagcccaaggttca
gaagattgcttatttctaaacgtctacacccctaaaaatggcacaaattcgaaaccagtg
atggtctgggttcatggtggtggctttaaaacaggttcaagtgagacggatttgcacgga
ccggagtatttaatgaccgaggatgttgttttggttactcttaactatcgactagggatt
ttgggttttttacggtttgaagaccaatctttgggtgttcccggaaacgccggtttgaaa
gacatggtaatggccttgaaatgggtgcaaagaaatataaaatatttttcgggtgatccc
aataatgtgacaatttttggcgaaagcgctggggctgcagctgtccattatctcgtcctt
tcacctttagccaaaggacttttccacagggctatcgcccaaagtgggtgtgccttaaat
gggttcgcgagaggtattcctgatacttcgaaacagttagctgcagctttggggatgcaa
acaacaaacgaaaaggaaatttttgagcgactctcgattttaccagtcgatgagttttta
caaatctcggaagaagtggcaaatatctggggtttgaaaaaagtctatgcgccagttgtt
gatggagaatttttaacagatgagccaattgcgattatcaagtctggggattataatcac
gttccgatgatttttgggtacacaactcgagagggaatgattgttgaaatgatgaggaaa
aatgaaacgccaggaatgccaaatgattttgaagagtttgtgcacccaacagtggccaaa
cgtgggtcaattacttcgaaaaatgtagctaataaaattcgggatttttattatgaagga
ccgaattcagaaaataacttggacaatttttatttgattcacaccgacacgtattttctg
agagatatcatttttgctattcgccaacatgcaatcacggccaaatttccaatttatttg
tataggatgtctgtagaaactaaactgaacgtgtttaaaagaattggaaatatcaaagct
cctggagtttgtcatggagacgatattggatatttattcaaaacaaaattatctcccgaa
ttaaaaactggaagtttggaggaaatctcagtgaagcggtttgtgaaattttggacgaat
tttgccagaaatggtagtccaaatgttgatggaccagactggaaacccatcagcaaggaa
gaaatacactttatcgatatcggagagaatataacagttggtgttaatccagaacctgaa
cgcatgaagttttggactgatatttacaacagcaatccactgttcacacagtag
atgtccaacccaatagttaccattgaagagggtaaactcttgggtaagatatctaccaac
atcaacggtgaagagttctgtagttttcagggcgttccgtacgcccaacctcctattggg
catttgagattcaaagcacctcaagctccccagccctggactggcattagagacgcccta
tctgagggaaacaagtgctactctaaggacctacttttcaatctcccagcccagggttca
gaagattgcctgtttctaaacgtctacacccctaagaatggtacgaactccaaaccagtg
atggtctgggttcatggtggtggcttcaagacaggttcaagtgagactgatttgcacgga
cctgagtatcttatgaccgaggatgttgttttggtaactcttaactaccgtctagggata
ttgggtttcttaagatttgaggaccagtccttgggcgttcctggaaacgccggtttgaaa
gacatggtaatggcattgaagtgggtgcaaagaaacattaagtatttctccggtgatccc
aacaatgtcacaatttttggtgaaagcgctggtgctgcagctgtccattacctcgtcctt
tcacctctagccaagggactttttcacagggctatcgcacaaagtggttgtgccctgaat
gggtttgctagaggtatacctgatacttcgaaacagttagctgcggctttgggtatgcag
acaacgaacgaaaaggaaattttcgagcgactctcgattctaccagtcgatgagtttctt
caaatctctgaagaagtggcaaacatctggggcttgaaaaaggtctatgcgccagtagtt
gatggcgagttcctgacagatgagccaattgctataatcaagtccggggactataaccac
gttccgatgatttttggttacaccactcgagagggaatgattgttgaaatgatgaggaag
aatgaaactccaggaatgccaaatgattttgaagagttcgtgcatccaaccgtggccaaa
agaggttcaattacttccaaaaatgttgctaacaaaattcgcgacttttactatgaagga
cctaattcagaaaacaacttggacaatttctatcttattcacacagacacttactttctg
agagatatcatttttgctattcgtcagcatgcaatcactgccaaattcccaatttatttg
tacaggatgtctgtagagactaaactgaacgtgtttaaaagaattggaaatatcaaagct
cctggagtttgtcatggagacgacattggatatctgttcaaaacgaagctgtcccctgaa
ttaaagactggaagtttggaggaaatctcagtcaagagatttgtgaaattctggactaac
tttgccagaaatggtagtccaaatgttgatggaccagactggaagcccatctctaaggaa
gaaattcactttatcgacatcggagagaatataacagttggtgttaacccagaacccgaa
cgtatgaagttttggactgatatttacaacagcaatccactgttcacccaatag
5' End
3' End
NotesNo accession number or CDS was provided for recoded gene. Correspodning author was e-mailed on 1/17/2006 and CDS was provided on 1/18/2006.
Expression VectorpGAPZ AlphapGAPZ Alpha, pGAPZ B, pPICZ B
Assay MethodsSDS-PAGE, Western BlotSDS-PAGE, Western Blot, Densitometry
ResultsNo expressionHigh increase (For each contruct: pGAPZ Alpha: 7mg/L, pGAPZ B: 40mg/L, pPICZ B: 80mg/L)
Protein FunctionHydrolyzes carboxylesters
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons in TCE were modified or removed based on the codon usage of P. pastoris, which lead to an
increase in G+C content. 14+ out of 517 codons were modified in total. In 2 of the 3 contructs, a
GAP promoter was added in to promote expression.
Publication Author(s)Delroisse, J. M.; Dannau, M.; Gilsoul, J. J.; El Mejdoub, T.; Destain, J.; Portetelle, D.; Thonart, P.; Haubruge, E.; Vandenbol, M.
Corresponding AuthorMicheline Vandenbol
Corresponding AddressFUSAGX, Unite de Biologie animale et microbienne, Avenue Marechal Juin, 6 B-5030 Gembloux, Belgium.
Publication Year2005
Publication TitleExpression of a synthetic gene encoding a Tribolium castaneum carboxylesterase in Pichia pastoris
AbstractThis is the first report of an insect esterase efficiently expressed in the methylotrophic yeast Pichia pastoris (so far insect esterases have been produced only in the baculovirus system). Having isolated a Tribolium castaneum carboxylesterase cDNA (TCE), we were initially unable to express it in Escherichia coli or P. pastoris despite significant transcription levels. As codon usage bias is different in T. castaneum and P. pastoris, we assumed this was a possible explanation for the translational barrier observed in yeast. Accordingly, we designed and constructed by recursive PCR a synthetic TCE gene (synTCE) optimized for heterologous expression in P. pastoris, i.e., a gene in which certain TCE codons are replaced with synonymous codons 'preferred' in P. pastoris. When the altered gene was placed under the control of either the P. pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter or the inducible alcohol oxidase (AOX1) promoter and introduced on an expression vector into P. pastoris, its product was produced intracellularly. We also successfully explored the possibility of obtaining a secreted product: P. pastoris cells expressing an in-frame fusion of synTCE with the alpha-factor secretion signal under the control of the GAP promoter were found to secrete the recombinant esterase into the external medium (to a concentration of 7mg/L). In addition to this demonstration of TCE production in yeast, our results suggest that the GAP promoter could advantageously replace the AOX1 promoter as a driver of synTCE expression. TCE specific activity was approximately 5U/mg when p-nitrophenyl acetate was used as substrate.
JournalProtein Expr Purif. 42(2): 286-94.
SummaryPichia pastoris was modified with synTCE, a recoded version of the TCE gene, in order to increase expression of a insect carboxylesterase protein. Codons of the natural gene, TCE, were modified in order to attain the recoded synTCE gene. The natural gene did not produce any protein whereas all three constructs used with the synTCE gene produced high yields of protein. Since synTCE was able to create a much higher yield than the natural gene, synTCE can be considered very successful.
CommentsNo accession number or CDS was provided for recoded gene. Correspodning author was e-mailed on 1/17/2006 and CDS was provided on 1/18/2006.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=557
PubMed ID15946860
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site