Synthetic Gene DataBase
 

Synthetic Gene 133


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID123133
GenBank AccessionNC_001526
GenBank GI9627100
Gene NameE1E1 (16 E1-dm)
Gene Length (bp)19501950
Specieshuman papillomavirus (HPV-16)Homo sapiens
StrainsType 16human cervical cancer cell C33A
CDSatggctgatcctgcaggtaccaatggggaagagggtacgggatgtaatggatggttttat
gtagaggctgtagtggaaaaaaaaacaggggatgctatatcagatgacgagaacgaaaat
gacagtgatacaggtgaagatttggtagattttatagtaaatgataatgattatttaaca
caggcagaaacagagacagcacatgcgttgtttactgcacaggaagcaaaacaacataga
gatgcagtacaggttctaaaacgaaagtatttggtaagtccacttagtgatattagtgga
tgtgtagacaataatattagtcctagattaaaagctatatgtatagaaaaacaaagtaga
gctgcaaaaaggagattatttgaaagcgaagacagcgggtatggcaatactgaagtggaa
actcagcagatgttacaggtagaagggcgccatgagactgaaacaccatgtagtcagtat
agtggtggaagtgggggtggttgcagtcagtacagtagtggaagtgggggagagggtgtt
agtgaaagacacactatatgccaaacaccacttacaaatattttaaatgtactaaaaact
agtaatgcaaaggcagcaatgttagcaaaatttaaagagttatacggggtgagtttttca
gaattagtaagaccatttaaaagtaataaatcaacgtgttgcgattggtgtattgctgca
tttggacttacacccagtatagctgacagtataaaaacactattacaacaatattgttta
tatttacacattcaaagtttagcatgttcatggggaatggttgtgttactattagtaaga
tataaatgtggaaaaaatagagaaacaattgaaaaattgctgtctaaactattatgtgtg
tctccaatgtgtatgatgatagagcctccaaaattgcgtagtacagcagcagcattatat
tggtataaaacaggtatatcaaatattagtgaagtgtatggagacacgccagaatggata
caaagacaaacagtattacaacatagttttaatgattgtacatttgaattatcacagatg
gtacaatgggcctacgataatgacatagtagacgatagtgaaattgcatataaatatgca
caattggcagacactaatagtaatgcaagtgcctttctaaaaagtaattcacaggcaaaa
attgtaaaggattgtgcaacaatgtgtagacattataaacgagcagaaaaaaaacaaatg
agtatgagtcaatggataaaatatagatgtgatagggtagatgatggaggtgattggaag
caaattgttatgtttttaaggtatcaaggtgtagagtttatgtcatttttaactgcatta
aaaagatttttgcaaggcatacctaaaaaaaattgcatattactatatggtgcagctaac
acaggtaaatcattatttggtatgagtttaatgaaatttctgcaagggtctgtaatatgt
tttgtaaattctaaaagccatttttggttacaaccattagcagatgccaaaataggtatg
ttagatgatgctacagtgccctgttggaactacatagatgacaatttaagaaatgcattg
gatggaaatttagtttctatggatgtaaagcatagaccattggtacaactaaaatgccct
ccattattaattacatctaacattaatgctggtacagattctaggtggccttatttacat
aatagattggtggtgtttacatttcctaatgagtttccatttgacgaaaacggaaatcca
gtgtatgagcttaatgataagaactggaaatcctttttctcaaggacgtggtccagatta
agtttgcacgaggacgaggacaaggaaaacgatggagactctttgccaacgtttaaatgt
gtgtcaggacaaaatactaacacattatga
atggccgaccccgccggcaccaacggcgaggagggcaccggctgcaacggctggttctac
gtggaggccgtggtggagaagaagaccggcgacgccatcagcgacgacgagaacgagaac
gacagcgacaccggcgaggacctggtggacttcatcgtgaacgacaacgactacctgacc
caggccgagaccgagaccgcccacgccctgttcaccgcccaggaggccaagcagcaccgc
gacgccgtgcaggtgctgaagcgcaagtacctgggcagccccctgagcgacatcagcggc
tgcgtcgacaacaacatcagcccccgcctgaaggccatctgcatcgagaagcagagccgc
gccgccaagcgccgcctgttcgagagcgaggacagcggctacggcaacaccgaggtggag
acccagcagatgctgcaggtggagggccgccacgagaccgagaccccctgcagccagtac
agcggcggcagcggcggcggctgcagccagtacagcagcggcagcggcggcgagggcgtg
agcgagcgccacaccatctgccagacccctctgaccaacatcctgaacgtgctgaagacc
agcaacgccaaggccgccatgctggccaagttcaaggagctgtacggcgtgagcttcagc
gagctggtgcgccccttcaagagcaacaagagcacctgctgcgactggtgcatcgccgcc
ttcggcctgacccccagcatcgccgacagcatcaagaccctgctgcagcagtactgcctg
tacctgcacatccagagcctggcctgcagctggggcatggtggtgctgctgctggtgcgc
tacaagtgcggcaagaaccgcgagaccatcgagaagctgctgagcaagctgctgtgcgtg
agccccatgtgcatgatgatcgagcctcccaagcttcgcagcaccgccgccgccctgtac
tggtacaagaccggcatcagcaacatcagcgaggtgtacggcgacacccccgagtggatc
cagcgccagaccgtgctgcagcacagcttcaacgactgcaccttcgagctgagccagatg
gtgcagtgggcctacgacaacgacatcgtggacgacagcgagatcgcctacaagtacgcc
cagctggccgacaccaacagcaacgccagcgccttcctgaagagcaacagccaggccaag
atcgtgaaggactgcgccaccatgtgccgccactacaagcgcgccgagaagaagcagatg
agcatgagccagtggatcaagtaccgctgcgaccgcgtggacgacggcggcgaccgcaag
cagatcgtgatgttcctgcgctaccagggcgtggaattcatgagcttcctgaccgccctg
aagcgcttcctgcagggcatccccaagaagaactgcatcctgctgtacggcgccgccaac
accgacaagagcctgttcggcatgagcctgatgaagttcctgcagggcagcgtgatctgc
ttcgtgaacagcaagagccacttctggctgcagcccctggccgacgccaagatcggcatg
ctggacgacgccaccgtgccctgctggaactacatcgacgacaacctgcgcaacgccctg
gacggcaacctggtgagcatggacgtgaagcaccgccccctggtgcagctgaagtgccct
cccctgctgatcaccagcaacatcaacgccggcaccgacagccgctggccctacctgcac
aaccgcctggtggtgttcaccttccccaacgagttccccttcgacgagaacggtaacccc
gtgtacgagctgaacgacaagaactggaagagcttcttcagccgcacctggagccgcctg
agcctgcacgaggacgaggacaaggagaacgacggcgacagcctgcccaccttcaagtgc
gtgagcggccagaacaccaacaccctgtaa
5' End
3' End
NotesSource for the natural gene was not provided in the paper. GenBank Accession# NC_001526 is used.Sequence from United States Patent & Trademark office, publication # 20050075303.
Expression VectorpV1J
Assay MethodsBeta-gal assay, Replication assay, Immunoblotting, Western Blot
ResultsVery low.Does not support any detectable DNA replication.
Protein FunctionReplication protein.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodRecoded by employing codons that are most commonly used by highly expressed mammalian genes.
Publication Author(s)Wang, X. M.; Jansen, K. U.; McClements, W. L.
Corresponding AuthorWilliam L. McClements
Corresponding AddressDepartment of Microbial Vaccine Research, P O Box 4, West Point, PA 19486, USA.
Publication Year2003
Publication TitleDNA replicative functions of highly-expressed, codon-optimized human papillomavirus proteins E1 and E2
AbstractHuman papillomavirus (HPV) DNA replication requires functional HPV early (E) proteins E1 and E2. To determine the biological activity of HPV 16 E1 and E2 mutant proteins under consideration as vaccine candidates, we developed a sensitive real time PCR assay that monitors HPV origin-of-replication-driven DNA synthesis. The assay was used to determine the DNA replicative functions of highly-expressed, codon-optimized HPV 16 E1 and E2 wild type and mutant proteins in transient transfections. Under the assay conditions, the HPV 16 E1 mutant (W439R, G482D) did not support HPV origin-driven DNA synthesis. In contrast, however, an HPV 16 E2 mutant bearing an E39A substitution, reported previously to be severely compromised for DNA replication, was found to be reduced only two-fold in activity and, therefore, considered not sufficiently inactivated for use in vaccines that depend on endogenous protein expression.
JournalJ Virol Methods. 108(1): 83-90.
SummaryTo determine the biological activity of HPV 16 E1 and E2 mutant proteins under consideration as vaccine candidates, codon-optimized HPV 16 E1 and E2 wild type and mutant genes were used. The codon optimized genes were constructed by employing codons that are most commonly used by highly expressed mammalian genes. The results showed that the HPV16 origin-driven DNA replication required both E1 and E2. The codon-optimized HPV16 E1 double mutant did not support any detectable DNA replication, but HPV 16 E2 single mutant as well as double mutant retained substantial DNA replication function. However, only codon-optimized wild type E1, together with codon-optimized wild type E2 support significant replication.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=626
PubMed ID12565157
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site