Synthetic Gene DataBase
 

Synthetic Gene 135


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID125135
GenBank AccessionU36202
GenBank GI1019893
Gene NameGFP-S65TGFPmut1
Gene Length (bp)795795
SpeciesAequorea victoriaHomo sapien; Chinese hamster
Strains293T (embryonic kidney cells); CHO-K1 (ovary)
CDSatgggtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactacttttacgtatggtgttcaatgcttttcaagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaagtccgga
ctcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatcc
accggatctagataa
atgggtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactctgacttatggtgttcaatgcttttcaagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaagtccgga
ctcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatcc
accggatctagataa
5' End
3' End
NotesGFP-S65T was only recoded at amino acid 64 and 65 according to Table 1 of Cormack et. al 1995.
Expression VectorpS65T-C1pGFPmut1-C1
Assay MethodsFACS, Fluorescence microscopyFACS
ResultsFluorescence was low compared to enhanced GFP versions in both FACS and microscopy assays.~4x improvement over GFP-S65T
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByClontech
Recoding MethodPhe64Leu (TTT190CTG), Thr65Thr (ACG193ACT)
Publication Author(s)Yang, T. T.; Cheng, L.; Kain, S. R.
Corresponding AuthorSteven R. Kain
Corresponding AddressCell Biology Group, CLONTECH Laboratories Inc., Palo Alto, CA 94303-4230, USA.
Publication Year1996
Publication TitleOptimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein
AbstractThe green fluorescent protein (GFP) from Aequorea victoria is a versatile reporter protein for monitoring gene expression and protein localization in a variety of cells and organisms. Despite many early successes using this reporter, wild type GFP is suboptimal for most applications due to low fluorescence intensity when excited by blue light (488 nm), a significant lag in the development of fluorescence after protein synthesis, complex photoisomerization of the GFP chromophore and poor expression in many higher eukaryotes. To improve upon these qualities, we have combined a mutant of GFP with a significantly larger extinction coefficient for excitation at 488 nm with a re-engineered GFP gene sequence containing codons preferentially found in highly expressed human proteins. The combination of improved fluorescence intensity and higher expression levels yield an enhanced GFP which provides greater sensitivity in most systems.
JournalNucleic Acids Res. 24(22): 4592-3.
SummaryA single amino acid variant was of GFP, GFP-S65T, was discovered by Heim et al which could fluoresce 5x more brightly than wild-type GFP. Later, Cormack et al put GFP through a series of aa mutations and created GFPmut1, which fluoresce even more brightly than GFP-S65T. The authors of this paper compare the fluorescence of GFP-S65T, GFPmut1, and EGFP (humanized GFPmut1) expression inside human cells. The sensitivity of the reporter gene was found to be increasingly higher with each modification. The recoding done by the authors eventually improved the fluorescence intensity of the GFP by 35x from the wild-type. Although this number may seem very high, the result comes from a combination of both amino acid modification and recoding of the base pair sequence. The respective contributions were not determined in this paper.
CommentsRecoding methods are not described in this paper. There are two references made on recoding: Chui, W et al. (1996) Curr. Biol. 6, 325-330 AND Hass, J., Park E.-C. and Seed, B. (1996) Curr. Biol. 6, 315-324
Discussion
PubMed ID8948654
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site