Synthetic Gene DataBase
 

Synthetic Gene 137


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID126137
GenBank AccessionAY835781AY531263
GenBank GI6065213242540974
Gene Namegaggag (consensus B)
Gene Length (bp)15031503
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Macaca mulatta
StrainsType 1293T cells
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagataaatgggaaagaattcgg
ttaaggccagggggaaggaaaaaatataaattgaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctggaacagctacaaccagctcttcagacaggatcagaagaacttagatcattatttaat
acagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagct
ttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggaaacagcggcaaggtcagccaaaattaccctatagtgcagaacctccaggga
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggggccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaggagaccatcaatgaggaagctgcagaatgggatagattgcatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atctataaaagatggataattctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaggaaccctttagagattatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagca
gctacactagaagaaatgatgacagcatgtcagggagtgggaggacccggccataaagca
agagttttggctgaagccatgagccaagtaacaaatccagctaccataatggtacagaga
ggcaattttaggaaccaaagaaaggctgttaagtgtttcaattgtggcaaagaagggcac
atagccagaaattgcagggcccccaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
cacaagggaaggcccgggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtttggggaggagacaacagctccctctcagaagcaggagccgatagac
aaggaaatgtatcctttagcttccctcagatcactctttggcaacgacccctcgtcacaa
taa
atgggcgcccgcgccagcgtgctgagcggcggcgagctggaccgctgggagaagatccgc
ctgcgccccggcggcaagaagaagtacaagctgaagcacatcgtgtgggccagccgcgag
ctggagcgcttcgccgtgaaccccggcctgctggagaccagcgagggctgccgccagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgcgcagcctgtacaac
accgtggccaccctgtactgcgtgcaccagcgcatcgaggtgaaggacaccaaggaggcc
ctggagaagatcgaggaggagcagaacaagagcaagaagaaggcccagcaggccgccgcc
gacaccggcaacagcagccaagtgagccagaactaccccatcgtgcagaacctgcagggc
cagatggtgcaccaggccatcagcccccgcaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggcgccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggaccgcctgcaccccgtgcacgcc
ggccccatcgcccccggccagatgcgcgagccccgcggcagcgacatcgccggcaccacg
agcaccctgcaggagcagatcggctggatgaccaacaacccccctatccccgtgggcgag
atctacaagcgctggatcatcctgggcctgaacaagatcgtgcgcatgtacagccccacg
agcatcctggacatccgccagggccccaaggagcccttccgcgactacgtggaccgcttc
tacaagaccctgcgggccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggccccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
cgcgtgctggccgaggccatgagccaggtgaccaacagcgccaccatcatgatgcagcgc
ggcaacttccgcaaccagcgcaagaccgtgaagtgcttcaactgcgggaaggagggccac
atcgccaagaactgccgcgccccccgcaagaagggctgctggaagtgcggcaaggagggg
caccagatgaaggactgcaccgagcgccaggccaacttcctgggcaagatctggcccagc
cacaagggccgccccggcaacttcctgcagagccgccccgagcccaccgcccctcccgag
gagagcttccgcttcggcgaggagaccaccacccccagccagaagcaggagcccatcgac
aaggagctgtaccccctggccagcctgcgcagcctgttcggcaacgaccccagcagccag
taa
5' End
3' End
NotesThe natural gene gag was not used alone in the experiment. Source for the sequence was not provided. Thus, GenBank Accession# AY835781 is used.GenBank Accession# AY531263 is provided by the authors.
Expression VectorpGA1
Assay MethodsELISA, Western Blot, ELISAPOT & ICC assays, SOFTmax 2.3 software
ResultsIncrease expression of gag.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized for human. Done by GeneArt.
Publication Author(s)Smith, J. M.; Amara, R. R.; Campbell, D.; Xu, Y.; Patel, M.; Sharma, S.; Butera, S. T.; Ellenberger, D. L.; Yi, H.; Chennareddi, L.; Herndon, J. G.; Wyatt, L. S.; Montefiori, D.; Moss, B.; McClure, H. M.; Robinson, H. L.
Corresponding AuthorHarriet L.Robinson
Corresponding AddressEmory Vaccine Center, Emory University School of Medicine, Atlanta, Georgia 30329, USA.
Publication Year2004
Publication TitleDNA/MVA vaccine for HIV type 1: effects of codon-optimization and the expression of aggregates or virus-like particles on the immunogenicity of the DNA prime
AbstractRecently, a vaccine consisting of DNA priming followed by boosting with modified vaccinia Ankara (MVA) has provided long-term protection of rhesus macaques against a virulent challenge with a chimera of simian and human immunodeficiency viruses. Here, we report studies on the development of the DNA component for a DNA/MVA HIV vaccine for humans. Specifically, we assess the ability of a codon-optimized Gag-expressing DNA and two noncodon-optimized Gag-Pol-Env-expressing DNAs to prime the MVA booster dose. The codon-optimized DNA expressed virus-like particles (VLPs), whereas one of the noncodon-optimized DNAs expressed VLPs and the other expressed aggregates of HIV proteins. The MVA boost expressed Gag-Pol and Env and produced VLPs. Immunogenicity studies in macaques used one intramuscular prime with 600 microg of DNA and two intramuscular boosts with 1 x 10(8) pfu of MVA at weeks 8 and 30. The codon-optimized and noncodon-optimized DNAs proved similar in their ability to prime anti-Gag T cell responses. The aggregate and VLP-expressing Gag-Pol-Env DNAs also showed no significant differences in their ability to prime anti-Env Ab responses. The second MVA booster dose did not increase the peak CD4 and CD8 T cell responses, but increased anti-Env Ab titers by 40- to 90-fold. MVA-only immunizations elicited 10-100 times lower frequencies of T cells and 2-4 lower titers of anti-Env Ab than the Gag-Pol-Env DNA/MVA immunizations. Based on the breadth of the T cell response and a trend toward higher titers of anti-Env Ab, we are moving forward with human trials of the noncodon-optimized VLP-expressing DNA.
JournalAIDS Res Hum Retroviruses. 20(12): 1335-47.
SummaryTo improve the DNA prime for DNA/MVA HIV vaccine, the constructions of two new candidate HIV DNA vaccines were done. The first was a noncodon-optimized Gag-Pol-Env vaccine, expressing VLPs containing Env. The second was a synthetic, codon-optimized Gag DNA expressing the consensus sequence for subtype B HIV-1 and also it produces VLPs. Then, experiments were done to compare the expression and immunogenicity in macaques of these two candidates. As expected, vaccine pGA1/JS8, which was constructed by cloning a synthetic codon-optimized clade B consensus gag gene into pGA1, expressed higher level of Gag, but not Env, than noncodon-optimized construct, Gag-Pol-Env vaccine. Despite that, codon-optimized gag DNA failed to prime higher or broader anti-Gag ELISPOT responses than the noncodon-optimized Gag-Pol-Env vaccine. The noncodon-optimized Gag-Pol-Env DNA expressing VLPs vector elicited broader cellular responses, expressed highest levels of Env antigen, and primed the highest levels of anti-Env antibody. It was chosen to take forward as a candidate.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=643
PubMed ID15650426
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site