Synthetic Gene DataBase
 

Synthetic Gene 138


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID127138
GenBank AccessionBC095438
GenBank GI63102446
Gene NameHIS3synthetic HIS3
Gene Length (bp)156156
SpeciesHomo sapiensCandida albicans
StrainsSGY-243
CDSatgaagttttttgtttttgctttaatcttggctctcatgctttccatgactggagctgat
tcacatgcaaagagacatcatgggtataaaagaaaattccatgaaaagcatcattcacat
cgaggctatagatcaaattatctgtatgacaattga
atgaaattttttgtttttgctttgattttggctttgatgttgtctatgactggtgctgat
tctcatgctaaaagacatcatggttataaaagaaaattccatgaaaaacatcattctcat
agaggttatagatcaaattatttgtatgataattaa
5' End
3' End
NotesBoth natural and recoded genes had a CaMAL2 promoter attached to the 3' UTR end of the gene.No accession number provided for recoded gene. Both natural and recoded genes had a CaMAL2 promoter attached to the 3’ UTR end.
Expression VectorpX-RP10pX-RP10
Assay MethodsRT-PCR Analysis, ATP level analysisRT-PCR Analysis, ATP level analysis
ResultsSignificant amount (Lower ATP levels and call viability than recoded gene)Significant increase in protein and fungicidal effectiveness (Higher induced ATP level led to conclusion of better functioning and, most likely, more protein)
Protein FunctionAnti-microbiral activity against bacteria and fungi in salivatory glands.
Recoding PurposeIntracellular expression of protein
Synthesized ByAuthors
Recoding MethodHIS3 codons were modified based on the codon usage patterns of C, albicans. A CaMAL2 promoter region
was attached to the 3’ end of the gene.
Publication Author(s)Baev, D.; Li, X.; Edgerton, M.
Corresponding AuthorMira Edgerton
Corresponding AddressDepartment of Oral Biology, School of Dental Medicine, State University of New York at Buffalo Main Street Campus, 3435 Main Street, Buffalo, NY 14214, USA.
Publication Year2001
Publication TitleGenetically engineered human salivary histatin genes are functional in Candida albicans: development of a new system for studying histatin candidacidal activity
AbstractHistatins are a structurally related family of salivary proteins known as histidine-rich proteins that are produced and secreted by the human major salivary glands. In vitro, histatins are potent cytotoxic proteins with selectivity for pathogenic yeasts including Candida albicans. Studies that investigate the mechanism of action of histatin proteins upon this important human pathogen have used a candidacidal assay in which the histatin is applied extracellularly. In order to develop a model system to study the mechanism of histatin action independently from binding and translocation events, the authors constructed C. albicans strains that contain chromosomally encoded human salivary histatin genes under the control of a regulated promoter. Intracellular expression of either histatin 5 or histatin 3 induced cell killing and ATP release in parallel. Since histatin killing can be initiated solely from intracellular sites, extracellular binding and internalization are preceding transport events. Thus the mechanism of histatin-induced ATP release does not require extracellular binding, and intracellular targets alone can activate ATP release. By employing a codon-optimization strategy it was shown that expression of heterologous sequences in C. albicans can be a useful tool for functional studies.
JournalMicrobiology. 147(Pt 12): 3323-34.
SummaryCandida albicans was transformed with synthetic HIS3, a recoded version of the HIS3 gene, in order to express protein intracellularly. HIS3 had its codons modified based on the codon usage patterns of C. albicans. Synthetic HIS3 had more protein with effect (less cell viability) than the natural gene, from this it can be concluded that more protein was made and that the recoded gene was successful since it produced more protein intracellularly.
Comments No accession number provided for recoded gene. No quantitative assay methods for determining the amount of protein were used. Instead, ATP was measured which would help to determine cell viability and, in essence, effectiveness and relative amount of protein. Both natural and recoded genes had a CaMAL2 promoter attached to the 3’ end.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=561
PubMed ID11739764
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site