Synthetic Gene DataBase
 

Synthetic Gene 139


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID128139
GenBank AccessionX83960U50963
GenBank GI6340101289497
Gene Namegfp10*gfph1
Gene Length (bp)714717
SpeciesAequorea victoriaHomo sapiens; Guinea pig
Strains293 (embryonic kidney cells); retina cells
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcaaaaattctctgtcaggggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactgggaagctacctgttccatggccaacactt
gtcactactttctcttatggtgtacaatgcttctcaagatacccagatcatatgaaacag
catgactttctcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttac
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgagggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
atggaatacaactataactcacataatgtatacatcatgggagacaaaccaaagaatggc
atcaaagttaacttcaaaattagacacaacattaaagatggaagcgttcaattagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcccaagatccccacggaaagagagatcacatggtcctt
cttgagtttgttacatctgctgggattacacatggcatggatgaactatacaaa
atgagcaagggcgaggaactgttcactggcgtggtcccaattctcgtggaactggatggc
gatgtgaatgggcacaaattttctgtcagcggagagggtgaaggtgatgccacatacgga
aagctcaccctgaaattcatctgcaccactggaaagctccctgtgccatggccaacactg
gtcactaccttctcttatggcgtgcagtgcttttccagatacccagaccatatgaagcag
catgactttttcaagagcgccatgcccgagggctatgtgcaggagagaaccatctttttc
aaagatgacgggaactacaagacccgcgctgaagtcaagttcgaaggtgacaccctggtg
aatagaatcgagctgaagggcattgactttaaggaggatggaaacattctcggccacaag
ctggaatacaactataactcccacaatgtgtacatcatggccgacaagcaaaagaatggc
atcaaggtcaacttcaagatcagacacaacattgaggatggatccgtgcagctggccgac
cattatcaacagaacactccaatcggcgacggccctgtgctcctcccagacaaccattac
ctgtccacccagtctgccctgtctaaagatcccaacgaaaagagagaccacatggtcctg
ctggagtttgtgaccgctgctgggatcacacatggcatggacgagctgtacaagtga
5' Endtgctctagagcggccgccgcaccatgagcaagggcgaggaactgtgctctagagcggccgccgcaccatgagcaagggcgaggaactg
3' Endatggacgagctgtacaagtgagcggccgcaagcttccgatggacgagctgtacaagtgagcggccgcaagcttccg
Notes*Sequence is actually gfp2 but very closely matches gfp10 sequence presented in Figure 1 of paper.humanized GFP with no further mutations
Expression VectorpBS-GFPH1pBS-GFPH
Assay MethodsFluorescence microscopy, FACSFluorescence microscopy, FACS
ResultsDisappointingly low fluorescence in mammalian system led the authors to try to improve expression through recoding.The sensitivity of the reporter gene was found to increase 22x for fluorescence microscopy.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByClontech
Recoding Method92 silent base pair substitutions made in 88 codons. Extremely rare codons were replaced, including
TTA and CTA for Leucine, TCG for Serine, and GTA for Valine. Other codons showed bias and were
recoded, although bias was not as dramatic.
Publication Author(s)Zolotukhin, S.; Potter, M.; Hauswirth, W. W.; Guy, J.; Muzyczka, N.
Corresponding AuthorNicholas Muzyczka
Corresponding AddressDepartment of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida 32610, USA.
Publication Year1996
Publication TitleA ""humanized"" green fluorescent protein cDNA adapted for high-level expression in mammalian cells
AbstractWe constructed gfph, a synthetic version of the jellyfish Aequorea victoria green fluorescent protein (gfp) cDNA that is adapted for high-level expression in mammalian cells, especially those of human origin. A total of 92 base substitutions were made in 88 codons in order to change the codon usage within the gfp10 coding sequence so that it was more appropriate for expression in mammalian cells. We also describe a series of versatile recombinant adeno-associated virus and adenovirus vectors for delivery and expression of genes into mammalian cells and, using these vectors, demonstrate the efficient transduction and expression of the gfph gene in the human cell line 293 and also in vivo, within neurosensory cells of guinea pig eye. Cells infected with recombinant adeno-associated virus-GFPH can be readily sorted by fluorescence-activated cell sorting, suggesting that the newly designed gfph gene could be widely used as a reporter in many gene delivery technologies, including human gene therapy.
JournalJ Virol. 70(7): 4646-54.
SummaryThe authors construct tried expressing a wild-type GFP in human embryonic kidney cells, but found very little fluorescence due to protein expression. The levels were not suitable for the reporter gene to be effective. The authors hypothesized that the codon preference of Aequorea victoria was quite different from that of humans and that complementary tRNA composition would not be able to efficiently translate the given wild-type mRNA sequence. Then, gfph was synthesized by replacing many very rare and relatively rare codons to humans. Also, placed a Kozak consensus sequence upstream of translation initiation as the sequence is known to enhance eukaryotic translation. A total of 92 bp substitutions were made, ultimately improving the sensitivity of the reporter gene 22x under fluorescence microscopy. A further mutation of Ser65 to Thr increased sensitivity from the wild-type gene by at least 45x under fluorescence microscopy and at least 190x with FACS analysis. This paper presents the best evidence that simply recoding GFP with no amino acid mutations can improve the heterologous expression of GFP in mammals.
CommentsThis is one of the few papers that presents the result of silent recoding of the GFP sequence alone. Most other papers show the results of recoding combined with amino acid mutations, which results in increased fluorescence intensity due to increased levels of expression as well as change in the protein structure that increases fluorescence intensity and persistence. The paper is a must read if you are interested in mammalian expression of GFP.
Discussion
PubMed ID8676491
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site