Synthetic Gene DataBase
 

Synthetic Gene 144


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID131144
GenBank AccessionAY587015M33262
GenBank GI57012259334647
Gene Namepolpol
Gene Length (bp)31833183
SpeciesSimian immunodeficiency virusHomo sapiens, Simian
StrainsSIVmac239H1299, 293
CDSgtgttggaattgtgggaaagagggacactctgcaaggcaatgcagagccccaagaagaca
gggatgctggaaatgtggaaaaatggaccatgttatggccaaatgcccagacagacaggc
gggttttttaggccttggtccatggggaaagaagccccgcaatttccccatggctcaagt
gcatcaggggctgatgccaactgctcccccagaggacccagctgtggatctgctaaagaa
ctacatgcagttgggcaagcagcagagagaaaagcagagagaaagcagagagaagcctta
caaggaggtgacagaggatttgctgcacctcaattctctctttggaggagaccagtagtc
actgctcatattgaaggacagcctgtagaagtattactggatacaggggctgatgattct
attgtaacaggaatagagttaggtccacattataccccaaaaatagtaggaggaatagga
ggttttattaatactaaagaatacaaaaatgtagaaatagaagttttaggcaaaaggatt
aaagggacaatcatgacaggggacaccccgattaacatttttggtagaaatttgctaaca
gctctggggatgtctctaaattttcccatagctaaagtagagcctgtaaaagtcgcctta
aagccaggaaaggatggaccaaaattgaagcagtggccattatcaaaagaaaagatagtt
gcattaagagaaatctgtgaaaagatggaaaaggatggtcagttggaggaagctcccccg
accaatccatacaacacccccacatttgctataaagaaaaaggataagaacaaatggaga
atgctgatagattttagggaactaaatagggtcactcaggactttacggaagtccaatta
ggaataccacaccctgcaggactagcaaaaaggaaaagaattacagtactggatataggt
gatgcatatttctccatacctctagatgaagaatttaggcagtacactgcctttacttta
ccatcagtaaataatgcagagccaggaaaacgatacatttataaggttctgcctcaggga
tggaaggggtcaccagccatcttccaatacactatgagacatgtgctagaacccttcagg
aaggcaaatccagatgtgaccttagtccagtatatggatgacatcttaatagctagtgac
aggacagacctggaacatgacagggtagttttacagtcaaaggaactcttgaatagcata
gggttttctaccccagaagagaaattccaaaaagatcccccatttcaatggatggggtac
gaattgtggccaacaaaatggaagttgcaaaagatagagttgccacaaagagagacctgg
acagtgaatgatatacagaagttagtaggagtattaaattgggcagctcaaatttatcca
ggtataaaaaccaaacatctctgtaggttaattagaggaaaaatgactctaacagaggaa
gttcagtggactgagatggcagaagcagaatatgaggaaaataaaataattctcagtcag
gaacaagaaggatgttattaccaagaaggcaagccattagaagccacggtaataaagagt
caggacaatcagtggtcttataaaattcaccaagaagacaaaatactgaaagtaggaaaa
tttgcaaagataaagaatacacataccaatggagtgagactattagcacatgtaatacag
aaaataggaaaggaagcaatagtgatctggggacaggtcccaaaattccacttaccagtt
gagaaggatgtatgggaacagtggtggacagactattggcaggtaacctggataccggaa
tgggattttatctcaacaccaccgctagtaagattagtcttcaatctagtgaaggaccct
atagagggagaagaaacctattatacagatggatcatgtaataaacagtcaaaagaaggg
aaagcaggatatatcacagataggggcaaagacaaagtaaaagtgttagaacagactact
aatcaacaagcagaattggaagcatttctcatggcattgacagactcagggccaaaggca
aatattatagtagattcacaatatgttatgggaataataacaggatgccctacagaatca
gagagcaggctagttaatcaaataatagaagaaatgattaaaaagtcagaaatttatgta
gcatgggtaccagcacacaaaggtataggaggaaaccaagaaatagaccacctagttagt
caagggattagacaagttctcttcttggaaaagatagagccagcacaagaagaacatgat
aaataccatagtaatgtaaaagaattggtattcaaatttggattacccagaatagtggcc
agacagatagtagacacctgtgataaatgtcatcagaaaggagaggctatacatgggcag
gcaaattcagatctagggacttggcaaatggattgtacccatctagagggaaaaataatc
atagttgcagtacatgtagctagtggattcatagaagcagaggtaattccacaagagaca
ggaagacagacagcactatttctgttaaaattggcaggcagatggcctattacacatcta
cacacagataatggtgctaactttgcttcgcaagaagtaaagatggttgcatggtgggca
gggatagagcacacctttggggtaccatacaatccacagagtcagggagtagtggaagca
atgaatcaccacctgaaaaatcaaatagatagaatcagggaacaagcaaattcagtagaa
accatagtattaatggcagttcattgcatgaattttaaaagaaggggaggaataggggat
atgactccagcagaaagattaattaacatgatcactacagaacaagagatacaatttcaa
caatcaaaaaactcaaaatttaaaaattttcgggtctattacagagaaggcagagatcaa
ctgtggaagggacccggtgagctattgtggaaaggggaaggagcagtcatcttaaaggta
gggacagacattaaggtagtacccagaagaaaggctaaaattatcaaagattatggagga
ggaaaagaggtggatagcagttcccacatggaggataccggagaggctagagaggtggca
tag
5' End
3' End
NotesGenbank Accession # is not provided in the paper.Thus, Genbank Accession #AY587015 is used.GenBank Accession# is provided by the authors. The synthetic sequence was generated by back-translating the amino acid sequence of the gag-pol coding region.
Expression VectorpcDNA3.1+pcDNA3.1+
Assay MethodsELISA, Western BlotELISA, Western Blot
ResultsUnd.etectableSignificant increased.
Protein Functionpol protein.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodApply codon usage occuring most frequently in mammalian cells.
Publication Author(s)Wagner, R.; Graf, M.; Bieler, K.; Wolf, H.; Grunwald, T.; Foley, P.; Uberla, K.
Corresponding AuthorDr. Ralf Wagner
Corresponding AddressInstitut fur Medizinische Mikrobiologie and Hygiene, Universitat Regensburg, D-93053 Regensburg, Germany. ralf.wagner@klinik.uni-ragansburg.da
Publication Year2000
Publication TitleRev-independent expression of synthetic gag-pol genes of human immunodeficiency virus type 1 and simian immunodeficiency virus: implications for the safety of lentiviral vectors
AbstractThe safety of lentiviral vectors for clinical applications is still a major concern. The gag-pol expression plasmids and the lentiviral vectors used in previous studies contain homologous regions, which constitute a risk for recombination events. Synthetic gag-pol genes of human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency virus (SIV) were therefore constructed, in which the codon usage was optimized for expression in human cells without altering the amino acid sequences. The synthetic gag-pol genes allowed efficient expression of these genes in the absence of Rev and the 5' untranslated leader region. Both the HIV-1 and the SIV synthetic gag-pol expression plasmids could mediate transduction of an SIV vector into nondividing human cells with titers of about 10(6) transducing units/ml. Similar titers were obtained with a four-plasmid vector-packaging system based on HIV-1. Using a biological assay, homologous recombination events between the synthetic gag-pol expression plasmids and an SIV vector were undetectable and in comparison with a previously used gag-pol expression plasmid at least approximately 100-fold less frequent. By eliminating regions of homology and sequences involved in packaging, synthetic gag-pol genes should improve the safety profile of lentiviral vectors.
JournalHum Gene Ther. 11(17): 2403-13.
SummaryTo avoid the formation and subsequent transfer of recombinants between packaging constructs and the vector, synthetic gag-pol genes of HIV-1 and SIV were constructed by codon optimization to express in human cells without altering the amino acid sequences. According to the experimental results, these synthetic genes allowed the efficient expression of gag-pol in the absence of viral elements. The homologous recombination events between the synthetic gag-pol expression plasmids and an SIV vector were undetectable.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=662
PubMed ID11096444
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site