Synthetic Gene DataBase
 

Synthetic Gene 145


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID132145
GenBank AccessionZ25876
GenBank GI398190
Gene NameH(A12-M)Y13EII-alpha-H(A12-M) Y13-GC-N
Gene Length (bp)720717
SpeciesBacillus amyloliquefaciens, Bacillus maceransHordeum vulgare
StrainsGrain, protoplast
CDSatgaaacgagtgttgctaattcttgtcaccggattgtttatgagtttgtgtgggatcact
tctagtgtttcggctcaaacaggcggatcgttttttgaaccttttaacagctttaatccg
agtacatgggaaaaggcagatgggtattccaatgggggggtgttcaattgcacatggcgt
gccaacaatgttaattttacgaatgatggaaagctcaagctgggcttaacgagttctgcg
tacaacaaatttgactgcgcggagtaccgatcaacgaacatttacggatacggcctgtac
gaggtcagtatgaagccagccaaaaatacaggaattgtctcatcctttttcacgtataca
ggacctgctcatggcacacaatgggatgaaatagatatcgaatttctaggaaaagacacg
acaaaagtccagtttaactattataccaatggggttggcggtcatgaaaaggttatctct
cttggctttgatgcatcaaagggcttccatacctatgctttcgattggcagccagggtat
attaaatggtatgtagacggtgttttgaaacataccgccaccgcgaatattccgagtacg
ccaggcaaaattatgatgaatctatggaacggaaccggagtggatgactggttaggttct
tataatggagcgaatccgttgtacgctgaatatgactgggtaaaatatacgagcaattaa
atggcgaacaaacatttgtccctctccctcttcctcgtcctccttggcctgtcggccagc
ttggcctccgggcagaccggcggcagcttcttcgagccgttcaacagcttcaacccgagc
acctgggagaaggccgacggctacagcaacggcggcgtcttcaactgcacctggcgcgcc
aacaacgtcaacttcaccaacgacggcaagctcaagctcggcctcaccagcagcgcctac
aacaagttcgactgcgccgagtaccgcagcaccaacatgtacggctacggcctctacgag
gtcagcatgaagccggccaagaacaccggcatcgtcagcagcttcttcacctacaccggc
ccggcccacggcacccagtgggacgagatcgacatcgagttcctcggcaaggacaccacc
aaggtccagttcaactactacaccaacggcgtcggcggccacgagaaggtcatcagcctc
ggcttcgacgccagcaagggcttccacacctacgccttcgactggcagccgggctacatc
aagtggtacgtcgacggcgtcctcaagcacaccgccaccgccaacatcccgagcaccccg
ggcaagatcatgatgaacctctggaacggcaccggcgtcgacgactggctcggcagctac
aacggcgccaacccgctctacgccgagtacgactgggtcaagtacaccagcaactga
5' End
3' End
NotesThe CDS and accession number for the natural gene was taken from the NBCI database using references cited in the article. The natural gene is actually a fusion of 2 genes from the species listed as sources and is the gene that it codon optimized to yield the recoded gene.No accession number provided for recoded gene.
Expression VectorpEmuGNpEmuGN, pUBARN
Assay MethodsSDS-PAGE, Western BlotSDS-PAGE, Western Blot
ResultsNo expressionSignificant increase (average of 40ng per 2 x 105 protoplasts)
Protein FunctionHydrolyzes glycosidic linkages in cell walls of endosperm.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe H(A12-M)Y13 gene had its codons replaced based on the codons of the barley
(1,3-1,4)-beta-glucanase isoenzyme EII making for a higher G+C content. The promoter for the
(1,3-1,4)-beta-glucanase isoenzyme EII was also fused to the gene.
Publication Author(s)Jensen, L. G.; Olsen, O.; Kops, O.; Wolf, N.; Thomsen, K. K.; von Wettstein, D.
Corresponding AuthorDiter von Wettstein
Corresponding AddressDepartment of Physiology, Gamle Carlsberg Vej 10, Copenhagen, Valby, Denmark.
Publication Year1996
Publication TitleTransgenic barley expressing a protein-engineered, thermostable (1,3-1,4)-beta-glucanase during germination
AbstractThe codon usage of a hybrid bacterial gene encoding a thermostable (1,3-1,4)-beta-glucanase was modified to match that of the barley (1,3-1,4)-beta-glucanase isoenzyme EII gene. Both the modified and unmodified bacterial genes were fused to a DNA segment encoding the barley high-pI alpha-amylase signal peptide downstream of the barley (1,3-1,4)-beta-glucanase isoenzyme EII gene promoter. When introduced into barley aleurone protoplasts, the bacterial gene with adapted codon usage directed synthesis of heat stable (1,3-1,4)-beta-glucanase, whereas activity of the heterologous enzyme was not detectable when protoplasts were transfected with the unmodified gene. In a different expression plasmid, the codon modified bacterial gene was cloned downstream of the barley high-pI alpha-amylase gene promoter and signal peptide coding region. This expression cassette was introduced into immature barley embryos together with plasmids carrying the bar and the uidA genes. Green, fertile plants were regenerated and approximately 75% of grains harvested from primary transformants synthesized thermostable (1,3-1,4)-beta-glucanase during germination. All three trans genes were detected in 17 progenies from a homozygous T1 plant.
JournalProc Natl Acad Sci U S A. 93(8): 3487-91.
SummaryBarley (Hordeum vulgare) was transformed with a recoded version of the hybrid H(A12-M)Y13 gene, EII-alpha-H(A12-M)Y13-GC-N, in order to increase protein expression in barley. H(A12-M)Y13 had its codons modified based on the codon usage patterns of the barley (1,3-1,4)-beta-glucanase isoenzyme EII. H(A12-M)Y13 yielded no protein or activity, whereas the recoded gene yielded a significant amount of the protein. It can be concluded that EII-alpha-H(A12-M)Y13-GC-N was successful since it was able to create more protein.
CommentsNo accession number provided for recoded gene. The CDS and accession number for the natural gene was taken from the NBCI database using references cited in the article. The natural gene is actually a fusion of 2 genes from the species listed as sources and is the gene that it codon optimized to yield the recoded gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=536
PubMed ID8622963
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site