Synthetic Gene DataBase
 

Synthetic Gene 148


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID135148
GenBank AccessionAF125673AJ313180
GenBank GI492771915212102
Gene NameL2oriL2h
Gene Length (bp)14221422
Specieshuman papillomavirus (HPV-16)Homo sapiens
StrainsType 16283T
CDSatgcgacacaaacgttctgcaaaacgcacaaaacgtgcatcggctacccaactttataaa
acatgcaaacaggcaggtacatgtccacctgacattatacctaaggttgaaggcaaaact
attgctgatcaaatattacaatatggaagtatgggtgtattttttggtgggttaggaatt
ggaacagggtcgggtacaggcggacgcactgggtatattccattgggaacaaggcctccc
acagctacagatacacttgctcctgtaagaccccctttaacagtagatcctgtgggccct
tccgatccttctatagtttctttagtggaagaaactagttttattgatgctggtgcacca
acatctgtaccttccattcccccagatgtatcaggatttagtattactacttcaactgat
accacacctgctatattagatattaataatactgttactactgttactacacataataat
cccactttcactgacccatctgtattgcagcctccaacacctgcagaaactggagggcat
tttacactttcatcatccactattagtacacataattatgaagaaattcctatggataca
tttattgttagcacaaaccctaacacagtaactagtagcacacccataccagggtctcgc
ccagtggcacgcctaggattatatagtcgcacaacacaacaagttaaagttgtagaccct
gcttttataaccactcccactaaacttattacatatgataatcctgcatatgaaggtata
gatgtggataatacattatatttttctagtaatgataatagtattaatatagctccagat
cctgactttttggatatagttgctttacataggccagcattaacctctaggcgtactggc
attaggtacagtagaattggtaataaacaaacactacgtactcgtagtggaaaatctata
ggtgctaaggtacattattattatgattttagtactattgattctgcagaagaaatagaa
ttacaaactataacaccttctacatatactaccacttcacatgcagccttacctacttct
attaataatggattatatgatatttatgcagatgactttattacagatacttctacaacc
ccggtaccatctgtaccctctacatctttatcaggttatattcctgcaaatacaacaatt
ccttttggtggtgcatacaatattcctttagtatcaggtcctgatatacccattaatata
actgaccaagctccttcattaattcctatagttccagggtctccacaatatacaattatt
gctgatgcaggtgacttttatttacatcctagttattacatgttacgaaaacgacgtaaa
cgtttaccatattttttttcagatgtctctttggctgcctag
atgaggcacaagaggagcgccaagaggaccaagagggccagcgccacccagctgtacaag
acctgcaagcaggccggcacctgcccccccgacatcatccccaaggtggagggcaagacc
atcgccgaccagatcctgcagtacggcagcatgggcgtgttcttcggcggcctgggcatc
ggcaccggcagcggcaccggcggcaggaccggctacatccccctgggcaccaggcccccc
accgccaccgacaccctggcccccgtgaggccccccctgaccgtggaccccgtgggcccc
agcgaccccagcatcgtgagcctggtggaggagaccagcttcatcgacgccggcgccccc
accagcgtgcccagcatcccccccgacgtgagcggcttcagcatcaccaccagcaccgac
accacccccgccatcctggacatcaacaacaccgtgaccaccgtgaccacccacaacaac
cccaccttcaccgaccccagcgtgctgcagccccccacccccgccgagaccggcggccac
ttcaccctgagcagcagcaccatcagcacccacaactacgaggagatccccatggacacc
ttcatcgtgagcaccaaccccaacaccgtgaccagcagcacccccatccccggcagcagg
cccgtggccaggctgggcctgtacagcaggaccacccagcaggtgaaggtggtggacccc
gccttcgtgaccacccccaccaagctgatcacctacgacaaccccgcctacgagggcatc
gacgtggacaacaccctgtacttcagcagcaacgacaacagcatcaacatcgcccccgac
cccgacttcctggacatcgtggccctgcacaggcccgccctgaccagcaggaggaccggc
atcaggtacagcaggatcggcaacaagcagaccctgaggaccaggagcggcaagagcatc
ggcgccaaggtgcactactactacgacctgagcaccatcgaccccgccgaggagatcgag
ctgcagaccatcacccccagcacctacaccaccaccagccacgccgccagccccaccagc
atcaacaacggcctgtacgacatctacgccgacgacttcatcaccgacaccagcaccacc
cccgtgcccagcgtgcccagcaccagcctgagcggctacatccccgccaacaccaccatc
cccttcggtggcgcctacaacatccccctggtgagcggccccgacatccccatcaacatc
accgaccaggcccccagcctgatccccatcgtgcccggcagcccccagtacaccatcatc
gccgacgccggcgacttctacctgcaccccagctactacatgctgaggaagaggaggaag
aggctgccctacttcttcagcgacgtgagcctggccgcctga
5' End
3' End
NotesGenbank accession # for native gene is not provided in the paper. AF125673 is used for the record.GenBank Accession No. is provided by the authors.
Expression VectorpUF3pUF3
Assay MethodsWestern Blot.Western Blot.
ResultsUndetectable.Significant increased.
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodcodon usage adopted for expression in human cells according to Kazuka codon
usage database
Publication Author(s)Leder, C.; Kleinschmidt, J. A.; Wiethe, C.; Muller, M.
Corresponding AuthorMartin Muller
Corresponding AddressForschungsschwerpunkt fur Angewandte Tumorvirologie, Deutsches Krebsforschungszentrum Heidelberg, 69120 Heidelberg, Germany.
Publication Year2001
Publication TitleEnhancement of capsid gene expression: preparing the human papillomavirus type 16 major structural gene L1 for DNA vaccination purposes
AbstractExpression of the structural proteins L1 and L2 of the human papillomaviruses (HPV) is tightly regulated. As a consequence, attempts to express these prime-candidate genes for prophylactic vaccination against papillomavirus-associated diseases in mammalian cells by means of simple DNA transfections result in insufficient production of the viral antigens. Similarly, in vivo DNA vaccination using HPV L1 or L2 expression constructs produces only weak immune responses. In this study we demonstrate that transient expression of the HPV type 16 L1 and L2 proteins can be highly improved by changing the RNA coding sequence, resulting in the accumulation of significant amounts of virus-like particles in the nuclei of transfected cells. Data presented indicate that, in the case of L1, adaptation for codon usage accounts for the vast majority of the improvement in protein expression, whereas translation-independent posttranscriptional events contribute only to a minor degree. Finally, the adapted L1 genes demonstrate strongly increased immunogenicity in vivo compared to that of unmodified L1 genes.
JournalJ Virol. 75(19): 9201-9.
SummaryThe goal of this study is to overcome the inefficient expression of HPV-16 L1 for vaccination purposes in cells which do not resemble differentiating keratinocytes. For this purpose, the synthetic HPV-16 L1 genes in which the codon usage was optimized for plant cells, Solanum tuberosum L1p, or mammalian cells, H. sapiens L1h, were constructed. In both constructs, the majority of the codons were modified while the encoded protein sequence remained unchanged. The experimental results showed that the codon optimized L1 genes increased the expression level and immunogenecity significantly compared to that of noncodon-optimized L1 genes.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=655
PubMed ID11533183
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site