Synthetic Gene DataBase
 

Synthetic Gene 149


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID136149
GenBank AccessionX52572
GenBank GI18923
Gene Name(1,3-1,4)-beta-glucanaserecombinant (1,3-1,4)-beta-glucanase
Gene Length (bp)10050
SpeciesHordeum vulgareHordeum vulgare
StrainsGrains
CDSatggcaggccaaggcgttgcctccatgttggctctggcattgctcctcggagccttcgcc
tccatcccacaaagcgtggagtccatcggggtgtgctacggcatgagcgccaacaatctg
ccggcggcgagcaccgtggtcaacatgttcaagtccaacgggatcaactccatgcggctg
tacgctcccgaccaggcggcgctgcaggcggtcggcggcacgggcgtgaacgttgttgtg
ggcgcgcccaacgacgtgctctccaacctcgccgccagtcccgcagcggctgcatcgtgg
gtgaggagcaacatccaggcgtaccccaaggtctccttccggtacgtctgcgtgggcaac
gaggtcgccggcggcgccacccagaaccttgtccccgccatgaagaacgtgcagggcgcg
ctggcctccgccgggctgggccacatcaaggtgaccacgtcggtgtcgcaggccatcctg
ggcgtgtacagcccgccgtccgccgggtccttcaccggagaggcggacgcgttcatgggc
cccgtggtgcagttccttgcccgcaccggcgcgccgctcatggccaacatctacccgtac
ctggcctgggcctacaacccgagcgccatggacatgagctacgcgctcttcaccgcgtcc
ggcaccgtggtccaggacggctcctacgggtaccagaacctgttcgacaccaccgtggac
gccttctacacggccatggccaagcacggcggctccaacgtgaagctggtggtgtccgag
agcgggtggccgtcagccggcggcacggcggcgaccccggccaacgccaggatctacaac
cagtacctcatcaaccacgtcgggcgcggcaccccccgccacccgggcgccatcgagacc
tacgtcttctccatgttcaacgagaaccagaaggacaacggcgtggagcagaactggggg
ctcttctaccccaacatgcagcacgtctaccccatcagcttctga
5' End
3' End
NotesNo accession number or CDS was provided. The natural gene CDS and accession number was taken based on references in the article.No accession number or CDS was provided for the natural gene or recoded gene. The corresponding author was e-mailed, but the CDS could not be obtained.
Expression VectorpJH2600pJH2600
Assay MethodsMcCleary Method, Suthern BlotMcCleary Method, Suthern Blot
ResultsVery little amounts (with D hordein promoter: up to .3 micrograms soluble protein, without: no protein yield)Significant increase (with D hordein promoter: up to 40microgram soluble protein, without: up to 5 micrograms soluble protein)
Protein FunctionHydrolyzes glycosidic linkages in cell walls of endosperm.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe natural gene was codon optimized in order to achieve a 63% GC content. One of the two recoded
contructs had a D hordein promoter fused to it as well.
Publication Author(s)Horvath, H.; Huang, J.; Wong, O.; Kohl, E.; Okita, T.; Kannangara, C. G.; von Wettstein, D.
Corresponding AuthorDiter von Wettstein
Corresponding AddressDepartment of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA. Getreidemarkt 9, A-1060 Wien, Austria.
Publication Year2000
Publication TitleThe production of recombinant proteins in transgenic barley grains
AbstractThe grain of the self-pollinating diploid barley species offers two modes of producing recombinant enzymes or other proteins. One uses the promoters of genes with aleurone-specific expression during germination and the signal peptide code for export of the protein into the endosperm. The other uses promoters of the structural genes for storage proteins deposited in the developing endosperm. Production of a protein-engineered thermotolerant (1, 3-1, 4)-beta-glucanase with the D hordein gene (Hor3-1) promoter during endosperm development was analyzed in transgenic plants with four different constructs. High expression of the enzyme and its activity in the endosperm of the mature grain required codon optimization to a C+G content of 63% and synthesis as a precursor with a signal peptide for transport through the endoplasmic reticulum and targeting into the storage vacuoles. Synthesis of the recombinant enzyme in the aleurone of germinating transgenic grain with an alpha-amylase promoter and the code for the export signal peptide yielded approximately 1 microgram small middle dotmg(-1) soluble protein, whereas 54 microgram small middle dotmg(-1) soluble protein was produced on average in the maturing grain of 10 transgenic lines with the vector containing the gene for the (1, 3-1, 4)-beta-glucanase under the control of the Hor3-1 promoter.
JournalProc Natl Acad Sci U S A. 97(4): 1914-9.
SummaryBarley (Hordeum vulgare) was transfored with a recoded version of the (1,3-1,4)-beta-glucanase gene, recombinant (1,3-1,4)-beta-glucanase, in order to increase the expression of (1,3-1,4)-beta-glucanase protein. The natural gene had its codons modified in order to achieve a 63% GC content and attain the recoded gene, recombinant (1,3-1,4)-beta-glucanase. The natural gene and recoded gene each had two constructs used, one with a D hordein promoter, the other without. The natural gene had a small yield with the promoter and without the promoter, there was no protein. The recoded gene had a very high increase with the promoter and a very little amount without the promoter. Overall, the recoded gene was successful, since in both cases there was more protein than the natural gene, but even more with a promoter and as a result can be considered very successful.
CommentsFour contructs were used. Two had the unmodified gene with one having a D hordein promoter. The other two were codon optimized and also had one with a D hordein promoter. No accession number or CDS was provided for the natural gene or recoded gene. The natural gene CDS and accession number was taken based on references in the article. One of the authors was e-mailed on 1/20/2006, but the CDS could not be obtained.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=549
PubMed ID10677555
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site