Synthetic Gene DataBase
 

Synthetic Gene 150


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID137150
GenBank AccessionK02007AF201927
GenBank GI3286587248702
Gene Namegaggag
Gene Length (bp)15091509
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
StrainsType 1 SF2293, mouse spleen cells.
CDSatgggtgcgagagcgtcggtattaagcgggggagaattagataaatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataagttaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaata
ttgggacagctacagccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagct
ttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagct
gcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaaccta
caggggcaaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagta
gtagaagaaaaggctttcagcccagaagtaatacccatgttttcagcattatcagaagga
gccaccccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatg
caaatgttaaaagagactatcaatgaggaagctgcagaatgggatagagtgcatccagtg
catgcagggcctattgcaccaggccaaatgagagaaccaaggggaagtgacatagcagga
actactagtacccttcaggaacaaataggatggatgacaaataatccacctatcccagta
ggagaaatctataaaagatggataatcctgggattaaataaaatagtaagaatgtatagc
cctaccagcattctggacataagacaaggaccaaaggaaccctttagagattatgtagac
cggttctataaaactctaagagccgaacaagcttcacaggatgtaaaaaattggatgaca
gaaaccttgttggtccaaaatgcaaacccagattgtaagactattttaaaagcattggga
ccagcagctacactagaagaaatgatgacagcatgtcagggagtggggggacccggccat
aaagcaagagttttggctgaagccatgagccaagtaacaaatccagctaacataatgatg
cagagaggcaattttaggaaccaaagaaagactgttaagtgtttcaattgtggcaaagaa
gggcacatagccaaaaattgcagggcccctaggaaaaagggctgttggagatgtggaagg
gaaggacaccaaatgaaagattgcactgagagacaggctaattttttagggaagatctgg
ccttcctacaagggaaggccagggaattttcttcagagcagaccagagccaacagcccca
ccagaagagagcttcaggtttggggaggagaaaacaactccctctcagaagcaggagccg
atagacaaggaactgtatcctttaacttccctcagatcactctttggcaacgacccctcg
tcacaataa
atgggcgcccgcgccagcgtgctgagcggcggcgagctggacaagtgggagaagatccgc
ctgcgccccggcggcaagaagaagtacaagctgaagcacatcgtgtgggccagccgcgag
ctggagcgcttcgccgtgaaccccggcctgctggagaccagcgagggctgccgccagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgcgcagcctgtacaac
accgtggccaccctgtactgcgtgcaccagcgcatcgacgtcaaggacaccaaggaggcc
ctggagaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gccgccggcaccggcaacagcagccaggtgagccagaactaccccatcgtgcagaacctg
cagggccagatggtgcaccaggccatcagcccccgcaccctgaacgcctgggtgaaggtg
gtggaggagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggc
gccaccccccaggacctgaacacgatgttgaacaccgtgggcggccaccaggccgccatg
cagatgctgaaggagaccatcaacgaggaggccgccgagtgggaccgcgtgcaccccgtg
cacgccggccccatcgcccccggccagatgcgcgagccccgcggcagcgacatcgccggc
accaccagcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtg
ggcgagatctacaagcggtggatcatcctgggcctgaacaagatcgtgcggatgtacagc
cccaccagcatcctggacatccgccagggccccaaggagcccttccgcgactacgtggac
cgcttctacaagaccctgcgcgctgagcaggccagccaggacgtgaagaactggatgacc
gagaccctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggctctcggc
cccgcggccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccac
aaggcccgcgtgctggccgaggcgatgagccaggtgacgaacccggcgaccatcatgatg
cagcgcggcaacttccgcaaccagcggaagaccgtcaagtgcttcaactgcggcaaggag
ggccacaccgccaggaactgccgcgccccccgcaagaagggctgctggcgctgcggccgc
gagggccaccagatgaaggactgcaccgagcgccaggccaacttcctgggcaagatctgg
cccagctacaagggccgccccggcaacttcctgcagagccgccccgagcccaccgccccc
cccgaggagagcttccgcttcggcgaggagaagaccacccccagccagaagcaggagccc
atcgacaaggagctgtaccccctgaccagcctgcgcagcctgttcggcaacgaccccagc
agccagtaa
5' End
3' End
NotesNatural gene was not used in the experiment.
Expression VectorpCMVKm2
Assay MethodsELISA, Immunoblotting, Western Blot
ResultsIncreased expression.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodOptimized for human codon usage.
Publication Author(s)zur Megede J, Chen MC, Doe B, Schaefer M, Greer CE, Selby M, Otten GR, Barnett SW.
Corresponding AuthorSusan W. Barnett
Corresponding AddressChiron Corporation, Emeryville, California 94608, USA.
Publication Year2000
Publication TitleIncreased expression and immunogenicity of sequence-modified human immunodeficiency virus type 1 gag gene.
AbstractA major challenge for the next generation of human immunodeficiency virus (HIV) vaccines is the induction of potent, broad, and durable cellular immune responses. The structural protein Gag is highly conserved among the HIV type 1 (HIV-1) gene products and is believed to be an important target for the host cell-mediated immune control of the virus during natural infection. Expression of Gag proteins for vaccines has been hampered by the fact that its expression is dependent on the HIV Rev protein and the Rev-responsive element, the latter located on the env transcript. Moreover, the HIV genome employs suboptimal codon usage, which further contributes to the low expression efficiency of viral proteins. In order to achieve high-level Rev-independent expression of the Gag protein, the sequences encoding HIV-1(SF2) p55(Gag) were modified extensively. First, the viral codons were changed to conform to the codon usage of highly expressed human genes, and second, the residual inhibitory sequences were removed. The resulting modified gag gene showed increases in p55(Gag) protein expression to levels that ranged from 322- to 966-fold greater than that for the native gene after transient expression of 293 cells. Additional constructs that contained the modified gag in combination with modified protease coding sequences were made, and these showed high-level Rev-independent expression of p55(Gag) and its cleavage products. Density gradient analysis and electron microscopy further demonstrated that the modified gag and gag protease genes efficiently expressed particles with the density and morphology expected for HIV virus-like particles. Mice immunized with DNA plasmids containing the modified gag showed Gag-specific antibody and CD8(+) cytotoxic T-lymphocyte (CTL) responses that were inducible at doses of input DNA 100-fold lower than those associated with plasmids containing the native gag gene. Most importantly, four of four rhesus monkeys that received two or three immunizations with modified gag plasmid DNA demonstrated substantial Gag-specific CTL responses. These results highlight the useful application of modified gag expression cassettes for increasing the potency of DNA and other gene delivery vaccine approaches against HIV.
JournalJ Virol.. 74(6): 2628-35.
SummaryTo achieve high –level Rev-independent expression of the gag gene of HIV-1SF2, the codon-optimized gag gene was constructed. The viral codons were replaced with codons of highly expressed human genes and the residual inhibitory sequences were removed. The gag protease expression cassettes, GP1 and GP2, were also constructed in the same manner. For GP1, the sequence from the gag stop codon to the codon for first 26 amino acids of the reverse transcriptase was codons optimized with subsequent INS inactivation. For GP2, modification was made on of INS inactivation alone. 293 cells were used for vitro expression and for vivo expression, mice and rhesus monkeys were used. Experiments were done and the results showed that the codon-optimized gag provided increased expression and immunogenicity.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=683
PubMed ID10684277
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site