Synthetic Gene DataBase
 

Synthetic Gene 151


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID138151
GenBank AccessionK02007AF202464
GenBank GI3286587229424
Gene Namegaggag (GP1)
Gene Length (bp)15091509
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
StrainsType 1 SF2293, mouse spleen cells.
CDSatgggtgcgagagcgtcggtattaagcgggggagaattagataaatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataagttaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaata
ttgggacagctacagccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagct
ttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagct
gcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaaccta
caggggcaaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagta
gtagaagaaaaggctttcagcccagaagtaatacccatgttttcagcattatcagaagga
gccaccccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatg
caaatgttaaaagagactatcaatgaggaagctgcagaatgggatagagtgcatccagtg
catgcagggcctattgcaccaggccaaatgagagaaccaaggggaagtgacatagcagga
actactagtacccttcaggaacaaataggatggatgacaaataatccacctatcccagta
ggagaaatctataaaagatggataatcctgggattaaataaaatagtaagaatgtatagc
cctaccagcattctggacataagacaaggaccaaaggaaccctttagagattatgtagac
cggttctataaaactctaagagccgaacaagcttcacaggatgtaaaaaattggatgaca
gaaaccttgttggtccaaaatgcaaacccagattgtaagactattttaaaagcattggga
ccagcagctacactagaagaaatgatgacagcatgtcagggagtggggggacccggccat
aaagcaagagttttggctgaagccatgagccaagtaacaaatccagctaacataatgatg
cagagaggcaattttaggaaccaaagaaagactgttaagtgtttcaattgtggcaaagaa
gggcacatagccaaaaattgcagggcccctaggaaaaagggctgttggagatgtggaagg
gaaggacaccaaatgaaagattgcactgagagacaggctaattttttagggaagatctgg
ccttcctacaagggaaggccagggaattttcttcagagcagaccagagccaacagcccca
ccagaagagagcttcaggtttggggaggagaaaacaactccctctcagaagcaggagccg
atagacaaggaactgtatcctttaacttccctcagatcactctttggcaacgacccctcg
tcacaataa
atgggcgcccgcgccagcgtgctgagcggcggcgagctggacaagtgggagaagatccgc
ctgcgccccggcggcaagaagaagtacaagctgaagcacatcgtgtgggccagccgcgag
ctggagcgcttcgccgtgaaccccggcctgctggagaccagcgagggctgccgccagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgcgcagcctgtacaac
accgtggccaccctgtactgcgtgcaccagcgcatcgacgtcaaggacaccaaggaggcc
ctggagaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gccgccggcaccggcaacagcagccaggtgagccagaactaccccatcgtgcagaacctg
cagggccagatggtgcaccaggccatcagcccccgcaccctgaacgcctgggtgaaggtg
gtggaggagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggc
gccaccccccaggacctgaacacgatgttgaacaccgtgggcggccaccaggccgccatg
cagatgctgaaggagaccatcaacgaggaggccgccgagtgggaccgcgtgcaccccgtg
cacgccggccccatcgcccccggccagatgcgcgagccccgcggcagcgacatcgccggc
accaccagcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtg
ggcgagatctacaagcggtggatcatcctgggcctgaacaagatcgtgcggatgtacagc
cccaccagcatcctggacatccgccagggccccaaggagcccttccgcgactacgtggac
cgcttctacaagaccctgcgcgctgagcaggccagccaggacgtgaagaactggatgacc
gagaccctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggctctcggc
cccgcggccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccac
aaggcccgcgtgctggccgaggcgatgagccaggtgacgaacccggcgaccatcatgatg
cagcgcggcaacttccgcaaccagcggaagaccgtcaagtgcttcaactgcggcaaggag
ggccacaccgccaggaactgccgcgccccccgcaagaagggctgctggcgctgcggccgc
gaaggacaccaaatgaaagattgcactgagagacaggctaattttttagggaagatctgg
ccttcctacaagggaaggccagggaattttcttcagagcagaccagagccaacagcccca
ccagaagagagcttcaggtttggggaggagaaaacaactccctctcagaagcaggagccg
atagacaaggaactgtatcctttaacttccctcagatcactctttggcaacgacccctcg
tcacagtaa
5' End
3' End
NotesNatural gene was not used in the experiment.gag-protease fusion protein GP1
Expression VectorpCMVKm2
Assay MethodsELISA, Immunoblotting, Western Blot
ResultsIncreased expression.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodOptimized for human codon usage.
Publication Author(s)zur Megede, J.; Otten, G. R.; Doe, B.; Liu, H.; Leung, L.; Ulmer, J. B.; Donnelly, J. J.; Barnett, S. W.
Corresponding AuthorJan zur Megede
Corresponding AddressChiron Corporation, Emeryville, California 94608, USA. Jan_zur_Megede@chiron.com
Publication Year2003
Publication TitleExpression and immunogenicity of sequence-modified human immunodeficiency virus type 1 subtype B pol and gagpol DNA vaccines
AbstractControl of the worldwide AIDS pandemic may require not only preventive but also therapeutic immunization strategies. To meet this challenge, the next generation of human immunodeficiency virus type 1 (HIV-1) vaccines must stimulate broad and durable cellular immune responses to multiple HIV antigens. Results of both natural history studies and virus challenge studies with macaques indicate that responses to both Gag and Pol antigens are important for the control of viremia. Previously, we reported increased Rev-independent expression and improved immunogenicity of DNA vaccines encoding sequence-modified Gag derived from the HIV-1(SF2) strain (J. zur Megede, M. C. Chen, B. Doe, M. Schaefer, C. E. Greer, M. Selby, G. R. Otten, and S. W. Barnett, J. Virol. 74: 2628-2635, 2000). Here we describe results of expression and immunogenicity studies conducted with novel sequence-modified HIV-1(SF2) GagPol and Pol vaccine antigens. These Pol antigens contain deletions in the integrase coding region and were mutated in the reverse transcriptase (RT) coding region to remove potentially deleterious enzymatic activities. The resulting Pol sequences were used alone or in combination with sequence-modified Gag. In the latter, the natural translational frameshift between the Gag and Pol coding sequences was either retained or removed. Smaller, in-frame fusion gene cassettes expressing Gag plus RT or protease plus RT also were evaluated. Expression of Gag and Pol from GagPol fusion gene cassettes appeared to be reduced when the HIV protease was active. Therefore, additional constructs were evaluated in which mutations were introduced to attenuate or inactivate the protease activity. Nevertheless, when these constructs were delivered to mice as DNA vaccines, similar levels of CD8(+) T-cell responses to Gag and Pol epitopes were observed regardless of the level of protease activity. Overall, the cellular immune responses against Gag induced in mice immunized with multigenic gagpol plasmids were similar to those observed in mice immunized with the plasmid encoding Gag alone. Furthermore, all of the sequence-modified pol and gagpol plasmids expressed high levels of Pol-specific antigens in a Rev-independent fashion and were able to induce potent Pol-specific T- and B-cell responses in mice. These results support the inclusion of a gagpol in-frame fusion gene in future HIV vaccine approaches.
JournalJ Virol. 77(11): 6197-207.
SummaryThe goal is to evaluate the expression and immunogenicity of novel sequence-modified HIV-1SF2 GagPol and Pol vaccine antigens. HIV-1 gag and pol expression cassettes were constructed based on the HIV-1SF2 isolate and were optimized for human codon usage. Modified gag and gagprotease cassettes, GP1 and GP2, constructions were described in Zur Megede et al., 2000. The construct gagFSpol was based on the GP2 cassette but was extended for pol up to the RNase H coding sequence. For gagCpol, the frameshift region was removed by insertion of an extra T nucleotide at the p1 slippery sequence in order to express the gag and pol genes in the frame. Experiments were done using human kidney 293 cells for vitro expression and female CB6F1 or C3H/HeN mice for vivo expression. Results showed that all of the sequenced modified pol and gagpol vaccine antigens provided the high-level expression and immunogenicity.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=684
PubMed ID12743276
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site