Synthetic Gene DataBase
 

Synthetic Gene 153


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID140153
GenBank AccessionAF125673
GenBank GI4927719
Gene NameE5 (HPV-16 E5)HPV-16 E5
Gene Length (bp)252252
Specieshuman papillomavirus (HPV-16)Homo sapiens
StrainsType 16NIH 3T3, COS-1 cells
CDSatgacaaatcttgatactgcatccacaacattactggcgtgctttttgctttgcttttgt
gtgcttttgtgtgtctgcctattaatacgtccgctgcttttgtctgtgtctacatacaca
tcattaatactattggtattactattgtggataacagcagcctctgcgtttaggtgtttt
attgtatatattgtatttgtttatataccattatttttaatacatacacatgcacgcttt
ttaattacataa
atgacaaatctggatactgcatccacaacactgctggcctgctttctgctgtgcttttgt
gtgctgctgtgtgtctgcctgctgatcaggcccctgctgctgtctgtgtctacatacaca
tccctgatcatcctggtgctgctgctgtggatcacagcagcctctgcctttaggtgtttt
attgtgtatattatctttgtgtatatcccactgtttctgatccatacacatgcacgcttt
ctgattacataa
5' Endttacatggatccgccaccatggcacctatcgctatataacaaatctggat
3' Endggatccttacat
Notesnatural gene was not used in the experiments. Expression level is almost the same as BPV-1 E5.
Expression VectorpJS55
Assay MethodsWestern Blot, Immunoprecipitation & Immunoblotting, immunofluorescence microscopy, Srckinase assay.
ResultsPositive.
Protein Functionmembrane protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodInfrequently used codons were replaced with more commonly used counterparts.
Publication Author(s)Suprynowicz, F. A.; Disbrow, G. L.; Simic, V.; Schlegel, R.
Corresponding AuthorRichard Schlegel
Corresponding AddressDepartment of Pathology, Georgetown University Medical School, Preclinical Sciences Building, Room GR10C, 3900 Reservoir Road, NW, Box #571432, Washington, DC 20057, USA.
Publication Year2005
Publication TitleAre transforming properties of the bovine papillomavirus E5 protein shared by E5 from high-risk human papillomavirus type 16?
AbstractThe E5 proteins of bovine papillomavirus type 1 (BPV-1) and human papillomavirus type 16 (HPV-16) are small (44-83 amino acids), hydrophobic polypeptides that localize to membranes of the Golgi apparatus and endoplasmic reticulum, respectively. While the oncogenic properties of BPV-1 E5 have been characterized in detail, less is known about HPV-16 E5 due to its low expression in mammalian cells. Using codon-optimized HPV-16 E5 DNA, we have generated stable fibroblast cell lines that express equivalent levels of epitope-tagged BPV-1 and HPV-16 E5 proteins. In contrast to BPV-1 E5, HPV-16 E5 does not activate growth factor receptors, phosphoinositide 3-kinase or c-Src, and fails to induce focus formation, although it does promote anchorage-independent growth in soft agar. These variant activities are apparently unrelated to differences in intracellular localization of the E5 proteins since retargeting HPV-16 E5 to the Golgi apparatus does not induce focus formation.
JournalVirology. 332(1): 102-13.
SummaryTo generate fibroblast cell lines that stably express epitope-tagged HPV-16 E5 and BPV E5 protein at the same level, the codon-optimized HPV-16 E5 DNA was used. This codon-optimized HPV-16 E5 was constructed by replacing infrequently used codons with more commonly used counterparts to increase expression in mammalian cells. The experiments were done using NIH 3T3 cells and COS cells. The results showed that HPV-16 E5 did not inhibit receptor activation and it did not share the ability of BPV E5 to activate PI 3-K and c-Src. Neither HPV-16 E5 nor BPV E5 enhanced EGF-dependent EGF-R activation in NIH 3T3 cells. In contrast to BPV-1 E5, HPV-16 E5 failed to induce focus formation.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=651
PubMed ID15661144
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site