Synthetic Gene DataBase
 

Synthetic Gene 154


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID141154
GenBank AccessionNM_000600.1
GenBank GI10834983
Gene NamehIL-6EchIL-6EcOp
Gene Length (bp)639572
SpeciesHomo sapiensEscherichia coli
StrainsN/ABL21
CDSatgaactccttctccacaagcgccttcggtccagttgccttctccctggggctgctcctg
gtgttgcctgctgccttccctgccccagtacccccaggagaagattccaaagatgtagcc
gccccacacagacagccactcacctcttcagaacgaattgacaaacaaattcggtacatc
ctcgacggcatctcagccctgagaaaggagacatgtaacaagagtaacatgtgtgaaagc
agcaaagaggcactggcagaaaacaacctgaaccttccaaagatggctgaaaaagatgga
tgcttccaatctggattcaatgaggagacttgcctggtgaaaatcatcactggtcttttg
gagtttgaggtatacctagagtacctccagaacagatttgagagtagtgaggaacaagcc
agagctgtgcagatgagtacaaaagtcctgatccagttcctgcagaaaaaggcaaagaat
ctagatgcaataaccacccctgacccaaccacaaatgccagcctgctgacgaagctgcag
gcacagaaccagtggctgcaggacatgacaactcatctcattctgcgcagctttaaggag
ttcctgcagtccagcctgagggctcttcggcaaatgtag
tcaccggttccgccgggtgaagactctaaagatgttgcggcgccgcccgtcagccgctga
cctcttctgaacgcattgacaaacaaattcgttacatcctggacggcatctctgccctgc
gtaaggagacctgtaacaaaagcaacatgtgtgaaagcagcaaagaagcgctggcagaag
cgctggcagaaaacaacctgaaccttccgaaaatggctgaaaaagatggttgcttccaat
ctggcttcaatgaagaaacttgcctggtgaaaatcatcaccggtcttttggagtttgaag
tatacctggaatatctgcagaaccgttttgaaagcagcgaggaacaagcgcgtgctgtgc
agatgagcaccaaagttctgatccagttcctgcagaaaaaggcgaaaaatctggatgcaa
tcactaccccggacccgaccaccaacgctagcctgctgacgaaactgcaggcgcagaacc
agtggctgcaggacatgaccactcatctgattctgcgcagctttaaagaattcctgcagt
ctagcctgcgcgctcttcgtcaaatgaatgca
5' End
3' End
NotesThe recoded gene sequence is significantly shorter than the sequence given for the wild type gene in GenBank. No explanation for this was given in the paper.
Expression VectorN/ApCH1A
Assay MethodsN/AWestern blot
ResultsThe Natural gene was not expressed in this experiment, however prior studies have shown a very low rate of expression in E. coli.The recoded gene showed an estimated 2- to 3-fold increase in protein product expression.
Protein FunctionMultifunctional cytokine, which also is an important component of the inflammatory cascade.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method was specified in Table 1 included in the paper.
Publication Author(s)Li, Y.; Chen, C. X.; von Specht, B. U.; Hahn, H. P.
Corresponding AuthorHeinz Hahn
Corresponding AddressChirurgische Forschung, Chirurgische Universitatsklinik, Hugstetter Strasse 55, D-79106 Freiburg i. Br., Germany
Publication Year2002
Publication TitleCloning and hemolysin-mediated secretory expression of a codon-optimized synthetic human interleukin-6 gene in Escherichia coli
AbstractPreviously, we constructed human interleukin-6 (hIL-6)-secreting Escherichia coli and Salmonella typhimurium strains by fusion of the hIL-6 cDNA to the HlyA(s) secretional signal, utilizing the hemolysin export apparatus for extracellular delivery of a bioactive hIL-6-hemolysin (hIL-6-HlyA(s)) fusion protein. Molecular analysis of the secretion process revealed that low secretion levels were due to inefficient gene expression. To adapt the codon usage in hIL-6 cDNA to the E. coli codon bias, a synthetic hIL-6Ec gene variant was constructed from 20 overlapping oligonucleotides, yielding a 561-bp fragment, which comprises the complete hIL-6 cDNA sequence. Genetic fusion of the hIL-6Ec gene with the hlyA(s) secretional signal as an integral part of the hemolysin operon resulted in 3-fold higher hIL-6-HlyA(s) secretion levels in E. coli, compared to a strain expressing the original hIL-6-hlyA(s) fusion gene. An increase in the electrophoretic mobility of secreted hIL-6-HlyA(s) in non-reducing SDS-PAGE, similar to that found for recombinant mature hIL-6, and the absence of such a mobility shift in the intracellular hIL-6-HlyA(s) protein fraction indicated that in hIL-6-HlyA(s) most probably correct intramolecular disulfide bond formation occurred during the secretion step. To confirm the disulfide bond formation, hIL-6-HlyA(s) was purified by a single-step immunoaffinity chromatography from culture supernatant in yields of 18 microg/L culture supernatant with purity in the range of 60%. These results demonstrate that codon usage has an impact on the hemolysin-mediated secretion of hIL-6 and, furthermore, provide evidence that the hemolysin system enables secretory delivery of disulfide-bridged proteins.
JournalProtein Expr Purif. 25(3): 437-47.
SummaryThe goal of this study was to optimize expression of human interleukin-6 protein in E. coli. The natural gene was not expressed in this study, but based on prior studies the optimized gene was shown to produce a 2- to 3-fold increase in protein. The results were found using Western blot analysis. These findings were consistent with the hypothesis of the author.
CommentsThe recoded gene is significantly shorter than the wild type gene given in GenBank, and no explanation for this was given in the paper.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=662#662
PubMed ID12182824
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site