Synthetic Gene DataBase
 

Synthetic Gene 155


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID143155
GenBank AccessionU63632
GenBank GI1465777
Gene NameEnv (gp120)Env (op.gp120)
Gene Length (bp)25440
Specieshuman Immunodeficiency Virus (HIV-1)Homo sapiens, Mus musculus
StrainsJRFL293T cells, mouse spleen cells
CDSatgagagtgaaggggatcaggaagagttatcagtacttgtggaaagggggcaccttgctc
cttgggatattaatgatctgtagtgctgtagaaaagttgtgggtcacagtctattatggg
gtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatat
gatacagaggtacataatgtttgggccacacatgcctgtgtacccacagaccccaaccca
caagaagtagtattggaaaatgtaacagaacattttaacatgtggaaaaataacatggta
gaacagatgcaggaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaa
ttaaccccactctgtgttactttaaattgcaaggatgtgaatgctactaataccactaat
gatagcgagggaacgatggagagaggagaaataaaaaactgctctttcaatatcaccaca
agcataagagatgaggtgcagaaagaatatgctcttttttataaacttgatgtagtacca
atagataataataataccagctataggttgataagttgtgacacctcagtcattacacag
gcctgtccaaagatatcctttgagccaattcccatacattattgtgccccggctggtttt
gcgattctaaagtgtaatgataagacgttcaatggaaaaggaccatgtaaaaatgtcagc
acagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgctaaatggc
agtctagcagaagaagaggtagtaattagatctgacaatttcacgaacaatgctaaaacc
ataatagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaataca
agaaaaagtatacatataggaccagggagagcattttatactacaggagaaataatagga
gatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaacag
atagttataaaattaagagaacaatttgagaataaaacaatagtctttaatcactcctca
ggaggggacccagaaattgtaatgcacagttttaattgtggaggagaatttttctactgt
aattcaacacaactgtttaatagtacttggaataataatactgaagggtcaaataacact
gaaggaaatactatcacactcccatgcagaataaaacaaattataaacatgtggcaggaa
gtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatatt
acagggctgctattaacaagagatggtggtattaatgagaatgggaccgagatcttcaga
cctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagta
aaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcaaagagaa
aaaagagcagtgggaataggagctgtgttccttgggttcttgggagcagcaggaagcact
atgggcgcagcgtcaatgacactgacggtacaggccagactattattgtctggtatagtg
caacagcagaacaatttgctgagggctattgaggcgcaacagcgtatgttgcaactcaca
gtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaggggat
caacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcct
tggaatgctagttggagtaataaatctctggataggatttggaataacatgacctggatg
gagtgggaaagagaaattgacaattacacaagcgaaatatacaccctaattgaagaatcg
cagaaccaacaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttg
tggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagta
ggaggcttagtaggtttaagactagtttttactgtactttctatagtgaatagagttagg
cagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacagg
cccgaaggaatcgaagaagaaggtggagagagagacagagacagatccggacgattagtg
aacggattcttagcacttatctgggtcgacctgcggagcctgtgcctcttcagctaccac
cgcttgagagacttactcttgactgtaacgaggattgtggaacttctgggacgcaggggg
tgggaagtcctgaaatattggtggaatctcctacagtattggagtcaggaactaaagaat
agtgctgttagcttgctcaatgccacagccatagcagtagctgaggggacagataggatt
atagaagcattacaaagaacttatagagctattctccacatacctacaagaataagacag
ggcttggaaagggctttgctataa
5' End
3' End
Notesgp160 precursor is cleaved into gp120 and gp41.The recoded gene was kindly provided by Dr. Brian Seed of Massachusetts General Hospital through the Division of AIDS, NIH. Awaiting reply from him for the sequence.
Expression VectorpTR600pTR600
Assay MethodsELISA, Western BlotELISA, Western Blot
ResultsPositive.Expression level is higher than that of wild-type.
Protein Functionenvelope glycoprotein
Recoding PurposeTo improve expression
Synthesized ByProvided by Dr. Brian Seed of Massachusetts Genera
Recoding MethodMost wild-type codons were replaced with codons from highly express human gene.
Publication Author(s)Liu, F.; Mboudjeka, I.; Shen, S.; Chou, T. H.; Wang, S.; Ross, T. M.; Lu, S.
Corresponding AuthorShan Lu
Corresponding AddressDepartment of Medicine, University of Massachusetts Medical School, 364 Plantation Street, Lazare Research Building, Worcester, MA 01605, USA.
Publication Year2004
Publication TitleIndependent but not synergistic enhancement to the immunogenicity of DNA vaccine expressing HIV-1 gp120 glycoprotein by codon optimization and C3d fusion in a mouse model
AbstractThe ability to elicit humoral and cell-mediated immune (CMI) responses from DNA immunization by combinational use of codon optimization and C3d component of complement was evaluated in this study. DNA vaccines that express either the wild type or the codon optimized gp120 gene coding for the envelope (Env) glycoprotein of human immunodeficiency virus (HIV-1) from the primary isolate JR-FL strain were compared to the same forms fused to three tandem copies of the murine C3d genes. Either codon optimization or C3d fusion alone was effective at generating early appearance, higher binding and neutralizing antibody responses. We also observed that cell-mediated immune responses against HIV Env could also be enhanced by C3d fusion. However, for both humoral and CMI responses, there were no synergistic effects when the combination of codon optimization and C3d fusion was employed.
JournalVaccine. 22(13-14): 1764-72.
SummaryThe goal of this study is to determine if a DNA vaccine design incorporating both codon optimization and C3d components would be able to produce synergistic effects to further improve the immunogenicity of the DNA vaccines. The codon-optimized gp120 coding for the envelope (Env) glycoprotein, which was provided by Dr. Brian Seed of Massachusetts General Hospital through the Division of AIDS, NIH, was used in this study. The codon-optimized gene was constructed by replacing most of the wild type codons with codons from highly expressed human genes. As expected, the results showed that the codon-optimization increased the level of expression of viral antigens. However, when it fused with the mC3d, the expression decreased. The results also showed that codon-optimized gene could induce excellent levels of temporal anti-gp120 IgG antibody responses, but combination of codon-optimization and C3d was not more immunogenic than either approach alone. Either codon-optimized gene alone or combination with C3d elicited very high titers of anti-gp120 IgG antibody responses and the two approaches also induced excellent levels of Env specific CMI responses than the wild type gp120. As mention in the paper, there was no evidence to suggest that the combination of both codon optimization and C3d was more effective than either approach alone. Thus, conclusion was made that there were no synergistic effects on homoral and CMI responses when the combination of codon-optimization and C3d fusion was employed.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=638
PubMed ID15068860
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site