Synthetic Gene DataBase
 

Synthetic Gene 156


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID144156
GenBank AccessionK03455
GenBank GI1906382
Gene Namegag-polgag-pol
Gene Length (bp)43074307
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1Hela cells, HT 1080 cells, 293T cells
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtgatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtgcatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaggaaccctttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaattcagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagattgttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtctggggtagagacaacaactccccctcagaagcaggagccgatagac
aaggaactgtatcctttaacttccctcaggtcactctttggcaacgacccctcgtcacaa
taaagataggggggcaactaaaggaagctctattagatacaggagcagatgatacagtat
tagaagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaattggaggtt
ttatcaaagtaagacagtatgatcagatactcatagaaatctgtggacataaagctatag
gtacagtattagtaggacctacacctgtcaacataattggaagaaatctgttgactcaga
ttggttgcactttaaattttcccattagccctattgagactgtaccagtaaaattaaagc
caggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagcat
tagtagaaatttgtacagagatggaaaaggaagggaaaatttcaaaaattgggcctgaaa
atccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaat
tagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaa
taccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatg
catatttttcagttcccttagatgaagacttcaggaagtatactgcatttaccataccta
gtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatgga
aaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaac
aaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttag
aaatagggcagcatagaacaaaaatagaggagctgagacaacatctgttgaggtggggac
ttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaac
tccatcctgataaatggacagtacagcctatagtgctgccagaaaaagacagctggactg
tcaatgacatacagaagttagtggggaaattgaattgggcaagtcagatttacccaggga
ttaaagtaaggcaattatgtaaactccttagaggaaccaaagcactaacagaagtaatac
cactaacagaagaagcagagctagaactggcagaaaacagagagattctaaaagaaccag
tacatggagtgtattatgacccatcaaaagacttaatagcagaaatacagaagcaggggc
aaggccaatggacatatcaaatttatcaagagccatttaaaaatctgaaaacaggaaaat
atgcaagaatgaggggtgcccacactaatgatgtaaaacaattaacagaggcagtgcaaa
aaataaccacagaaagcatagtaatatggggaaagactcctaaatttaaactgcccatac
aaaaggaaacatgggaaacatggtggacagagtattggcaagccacctggattcctgagt
gggagtttgttaatacccctcccttagtgaaattatggtaccagttagagaaagaaccca
tagtaggagcagaaaccttctatgtagatggggcagctaacagggagactaaattaggaa
aagcaggatatgttactaatagaggaagacaaaaagttgtcaccctaactgacacaacaa
atcagaagactgagttacaagcaatttatctagctttgcaggattcgggattagaagtaa
acatagtaacagactcacaatatgcattaggaatcattcaagcacaaccagatcaaagtg
aatcagagttagtcaatcaaataatagagcagttaataaaaaaggaaaaggtctatctgg
catgggtaccagcacacaaaggaattggaggaaatgaacaagtagataaattagtcagtg
ctggaatcaggaaagtactatttttagatggaatagataaggcccaagatgaacatgaga
aatatcacagtaattggagagcaatggctagtgattttaacctgccacctgtagtagcaa
aagaaatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatggacaag
tagactgtagtccaggaatatggcaactagattgtacacatttagaaggaaaagttatcc
tggtagcagttcatgtagccagtggatatatagaagcagaagttattccagcagaaacag
ggcaggaaacagcatattttcttttaaaattagcaggaagatggccagtaaaaacaatac
atactgacaatggcagcaatttcaccggtgctacggttagggccgcctgttggtgggcgg
gaatcaagcaggaatttggaattccctacaatccccaaagtcaaggagtagtagaatcta
tgaataaagaattaaagaaaattataggacaggtaagagatcaggctgaacatcttaaga
cagcagtacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggt
acagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattac
aaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccac
tttggaaaggaccagcaaagctcctctggaaaggtgaaggggcagtagtaatacaagata
atagtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattatggaaaac
agatggcaggtgatgattgtgtggcaagtagacaggatgaggattag
atgggcgcccgcgccagcgtgctgtcgggcggcgagctggaccgctgggagaagatccgc
ctgcgccccggcggcaaaaagaagtacaagctgaagcacatcgtgtgggccagccgcgaa
ctggagcgcttcgccgtgaaccccgggctcctggagaccagcgaggggtgccgccagatc
ctcggccaactgcagcccagcctgcaaaccggcagcgaggagctgcgcagcctgtacaac
accgtggccacgctgtactgcgtccaccagcgcatcgaaatcaaggatacgaaagaggcc
ctggataaaatcgaagaggaacagaataagagcaaaaagaaggcccaacaggccgccgcg
gacaccggacacagcaaccaggtcagccagaactaccccatcgtgcagaacatccaggtg
cagatggtgcaccaggccatctccccccgcacgctgaacgcctgggtgaaggtggtggaa
gagaaggctgttagcccggaggtgatacccatgttctcagccctgtcagagggagccacc
ccccaagatctgaacaccatgctcaacacagtggggggacaccaggccgccatgaagatg
ctgaaggagaccatcaatgaggaggctgccgaatgggatcgtgtgcatccggtgcacgca
gggcccatcgcaccgggccagatgcgtgagccacggggctcagacatcgccggaacgact
agtacccttcaggaacagatcggctggatgaccaacaacccacccatcccggtgggagaa
atctacaaacgctggatcatcctgggcctgaacaagatcgtgcgcatgtaatgccctacc
agcatcctggacatccgccaaggcccgaaggaaccctttcgcgactacgtggaccggttc
tacaaaacgctccgcgccgagcaggctagccaggaggtgaagaactggatgaccgaaacc
ctgctggtccagaacgcgaacccggactgcaagacgatcctgaaggccctgggcccagcg
gctaccctagaggaaatgatgaccgcctgtcagggagtgggcggacccggccacaaggca
cgcgtcctggctgaggccatgagccaggtgaccaactccgctaccatcatgatgcagcgc
ggcaactttcggaaccaacgcaagatcgtcaagtgcttcaactgtggcaaagaagggcac
acagcccgcaactgcagggcccctaggaaaaagggctcttggaaatctggaaaggaagga
caccaaatcaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
cacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtttggggaagagacaacaactccctctcagaagcaggagccgatagac
aaggaactgtatcctttagcttccctcagatcactctttggcagcgacccctcgtcacaa
taaagataggggggcagctcaaggaggctctcctggcacccggagcagacgacaccgtgc
tggaggagatgtcgttgccaggccgctggaagccgaagatgatcgggggaatcggcggtt
tcatcaaggtgcgccagtatgaccagatcctcatcgaaatctgcggccacaaggctatcg
gtaccgtgctggtgggccccacacccgtcaacatcatcggacgcaacctgttgacgcaga
tcggttgcacgctgaacttccccattagccctatcgagacggtaccggtgaagctgaagc
ccgggatggacggcccgaaggtcaagcaatggccattgacagaggagaagatcaaggcac
tggtggagatttgcacagagatggaaaaggaagggaaaatctccaagattgggcctgaga
acccgtacaacacgccggtgttcgcaatcaagaagaaggactcgacgaaatggcgcaagc
tggtggacttccgcgagctgaacaagcgctcgcaagacttctgggaggttcagctgggca
tcccgcaccccgcagggctgaagaagaagaaatccgtgaccgtactggatgtgggtgatg
cctacttctccgttcccctggacgaagacttcaggaagtacactgccttcacaatccctt
cgatcaacaacgagacaccggggattcgatatcagtacaacgtgctgccccagggctgga
aaggctctcccgcaatcttccagagtagcatgaccaaaatcctggagcctttccgcaaac
agaaccccgacatcgtcatctatcagtacatggatgacttgtacgtgggctctgatctag
agatagggcagcaccgcaccaagatcgaggagctgcgccagcacctgttgaggtggggac
tgaccacacccgacaagaagcaccagaaggagcctcccttcctctggatgggttacgagc
tgcaccctgacaaatggaccgtgcagcctatcgtgctgccagagaaagacagctggactg
tcaacgacatacagaagctggtggggaagttgaactgggccagtcagatttacccaggga
ttaaggtgaggcagctgtgcaaactcctccgcggaaccaaggcactcacagaggtgatcc
ccctaaccgaggaggccgagctcgaactggcagaaaaccgagagatcctaaaggagcccg
tgcacggcgtgtactatgacccctccaaggacctgatcgccgagatccagaagcaggggc
aaggccagtggacctatcagatttaccaggagcccttcaagaacctgaagaccggcaagt
acgcccggatgaggggtgcccacactaacgacgtcaagcagctgaccgaggccgtgcaga
agatcaccaccgaaagcatcgtgatctggggaaagactcctaagttcaagctgcccatcc
agaaggaaacctgggaaacctggtggacagagtattggcaggccacctggattcctgagt
gggagttcgtcaacacccctcccctggtgaagctgtggtaccagctggagaaggagccca
tagtgggcgccgaaaccttctacgtggatggggccgctaacagggagactaagctgggca
aagccggatacgtcactaaccggggcagacagaaggttgtcaccctcactgacaccacca
accagaagactgagctgcaggccatttacctcgctttgcaggactcgggcctggaggtga
acatcgtgacagactctcagtatgccctgggcatcattcaagcccagccagaccagagtg
agtccgagctggtcaatcagatcatcgagcagctgatcaagaaggaaaaggtctatctgg
cctgggtacccgcccacaaaggcattggcggcaatgagcaggtcgacaagctggtctcgg
ctggcatcaggaaggtgctattcctggatggcatcgacaaggcccaggacgagcacgaga
aataccacagcaactggcgggccatggctagcgacttcaacctgccccctgtggtggcca
aagagatcgtggccagctgtgacaagtggcagctcaagggcgaagccatgcatggccagg
tggactgtagccccggcatctggcaactcgattgcacccatctggagggcaaggttatcc
tggtagccgtccatgtggccagtggctacatcgaggccgaggtcattcccgctgaaacag
ggcaggagacagcctacttcctcctgaagctggcaggccggtggccagtgaagaccatcc
atactgacaatggcagcaatttcaccagtgctacggttaaggccgcctgctggtgggcgg
gaatcaagcaggagttcgggatcccctacaatccccagagtcagggcgtcgtcgagtcta
tgaataaggagttaaagaagattatcggccaggtcagagatcaggcagagcatctcaaga
ccgcggtccaaatggcggtattcatccacaatttcaagcggaagggggggattggtgggt
acagtgcgggggagcggatcgtggacatcatcgcgaccgacatccagactaaggagctgc
aaaagcagattaccaagattcagaatttccgggtctactacagggacagcagaaatcccc
tctggaaaggcccagcgaagctcctctggaatggtgagggggcagtagtgatccaggata
atagcgacatcaaggtggtgcccagaagaaaggcgaagatcattagggattatggcaaac
agatggcgggtgatgattgcgtggcgagcagacaggatgaggattag
5' End
3' End
Notes
Expression VectorpCNC-GPRTpCNC-SYNGP
Assay MethodsImmunoblotting, ELISA, Northern Blotting.Immunoblotting, ELISA, Northern Blotting.
ResultsLow expression.Increased expression.
Protein FunctionEnzyme precursor
Recoding PurposeTo improve expression
Synthesized ByKotsopoulou, E.Kim, V. N. Kingsman, A. J.Kingsman,
Recoding MethodThe codon-optimized gag-pol gene was constructed by annealing a series of short
overlapping oligonucleotides (approximately 30- to 40-mers; 9 nt of overlap). Codon optimization
was performed using the sequence of the HXB2 strain. A fragment from base 1222 from the beginning
of gag until the end of gag (base 1503) was not optimized in order to maintain the frameshift site
and the overlap between the gag and pol reading frames. This was from clone pNL4-3. The Kozak
consensus sequence for optimal translation initiation was also included. Full optimization for the
first 1221bp with the reference codon usage in highly expressed human genes.
Publication Author(s)Ikeda, Y.; Takeuchi, Y.; Martin, F.; Cosset, F. L.; Mitrophanous, K.; Collins, M.
Corresponding AuthorMary Collins
Corresponding AddressDepartment of Immunology and Molecular Pathology, Windeyer Institute, University College London, 46 Cleveland St., London W1T 4JF, UK.
Publication Year2003
Publication TitleContinuous high-titer HIV-1 vector production
AbstractHuman immunodeficiency virus type 1 (HIV-1)-based vectors are currently made by transient transfection, or using packaging cell lines in which expression of HIV-1 Gag and Pol proteins is induced. Continuous vector production by cells in which HIV-1 Gag-Pol is stably expressed would allow rapid and reproducible generation of large vector batches. However, attempts to make stable HIV-1 packaging cells by transfection of plasmids encoding HIV-1 Gag-Pol have resulted in cells which secrete only low levels of p24 antigen (20-80 ng/ml), possibly because of the cytotoxicity of HIV-1 protease. Infection of cells with HIV-1 can result in stable virus production; cell clones that produce up to 1,000 ng/ml secreted p24 antigen have been described. Here we report that expression of HIV-1 Gag-Pol by a murine leukemia virus (MLV) vector allows constitutive, long-term, high-level (up to 850 ng/ml p24) expression of HIV-1 Gag. Stable packaging cells were constructed using codon-optimized HIV-1 Gag-Pol and envelope proteins of gammaretroviruses; these producer cells could make up to 10(7) 293T infectious units (i.u.)/ml (20 293T i.u./cell/day) for at least three months in culture.
JournalNat Biotechnol. 21(5): 569-72.
SummaryTo determine the cell lines that would make the best stable HIV-1 packaging cells, p24 secretion was measured. Stable packaging cells were constructed using codon-optimized HIV-1 Gag-Pol. This codon-optimized HIV-1 gag-pol gene was constructed with codons frequently used by highly expressed human genes. The vectors pCNC-GPRT for wild type Gag-Pol and pCNC-SYNGP for codon-optimized Gag-Pol were either transfected into HeLa or HT1080 cells, or first packaged into MLV virions using a transient MLV packaging system and then used to infect HeLa, HT1080, or 293T cells. Experimental results showed that infection with codon-optimized pCNC-SYNGP vector gave a higher frequency of clones expressing HIV-1 p24 than the pCNC-GPRT vector.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=647
PubMed ID12679787
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site