Synthetic Gene DataBase
 

Synthetic Gene 157


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID145157
GenBank AccessionAH006907
GenBank GI183011
Gene NameGCBGBOPT
Gene Length (bp)16111611
SpeciesHomo sapiensPichia pastoris
StrainsKM71
CDSatggagttttcaagtccttccagagaggaatgtcccaagcctttgagtagggtaagcatc
atggctggcagcctcacaggattgcttctacttcaggcagtgtcgtgggcatcaggtgcc
cgcccctgcatccctaaaagcttcggctacagctcggtggtgtgtgtctgcaatgccaca
tactgtgactcctttgaccccccgacctttcctgcccttggtaccttcagccgctatgag
agtacacgcagtgggcgacggatggagctgagtatggggcccatccaggctaatcacacg
ggcacaggcctgctactgaccctgcagccagaacagaagttccagaaagtgaagggattt
ggaggggccatgacagatgctgctgctctcaacatccttgccctgtcaccccctgcccaa
aatttgctacttaaatcgtacttctctgaagaaggaatcggatataacatcatccgggta
cccatggccagctgtgacttctccatccgcacctacacctatgcagacacccctgatgat
ttccagttgcacaacttcagcctcccagaggaagataccaagctcaagatacccctgatt
caccgagccctgcagttggcccagcgtcccgtttcactccttgccagcccctggacatca
cccacttggctcaagaccaatggagcggtgaatgggaaggggtcactcaagggacagccc
ggagacatctaccaccagacctgggccagatactttgtgaagttcctggatgcctatgct
gagcacaagttacagttctgggcagtgacagctgaaaatgagccttctgctgggctgttg
agtggataccccttccagtgcctgggcttcacccctgaacatcagcgagacttcattgcc
cgtgacctaggtcctaccctcgccaacagtactcaccacaatgtccgcctactcatgctg
gatgaccaacgcttgctgctgccccactgggcaaaggtggtactgacagacccagaagca
gctaaatatgttcatggcattgctgtacattggtacctggactttctggctccagccaaa
gccaccctaggggagacacaccgcctgttccccaacaccatgctctttgcctcagaggcc
tgtgtgggctccaagttctgggagcagagtgtgcggctaggctcctgggatcgagggatg
cagtacagccacagcatcatcacgaacctcctgtaccatgtggtcggctggaccgactgg
aaccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgtcgacagtccc
atcattgtagacatcaccaaggacacgttttacaaacagcccatgttctaccaccttggc
cacttcagcaagttcattcctgagggctcccagagagtggggctggttgccagtcagaag
aacgacctggacgcagtggcactgatgcatcccgatggctctgctgttgtggtcgtgcta
aaccgctcctctaaggatgtgcctcttaccatcaaggatcctgctgtgggcttcctggag
acaatctcacctggctactccattcacacctacctgtggcgtcgccagtga
atggagttttcaagtccttccagagaggaatgtcccaagcctttgagtagggtaagcatc
atggctggcagcctcacaggattgcttctacttcaggcagtgtcgtgggcatcaggtgct
agaccatgtattccaaagtctttcggttactcttctgttgtttgtgtttgtaacgctact
tactgtgactctttcgacccaccaactttcccagctttgggtactttctctagatacgaa
tctactagatctggtagaagaatggaattgtctatgggtccaattcaagctaaccacact
ggcacaggcctgctactgaccctgcagccagaacagaagttccagaaagtgaagggattt
ggaggggccatgacagatgctgctgctctcaacatccttgccctgtcaccccctgcccaa
aatttgctacttaaatcgtacttctctgaagaaggaatcggatataacatcatccgggta
cccatggccagctgtgacttctccatccgcacctacacctatgcagacacccctgatgat
ttccagttgcacaacttcagcctcccagaggaagataccaagctcaagatacccctgatt
caccgagccctgcagttggcccagcgtcccgtttcactccttgccagcccctggacatca
cccacttggctcaagaccaatggagcggtgaatgggaaggggtcactcaagggacagccc
ggagacatctaccaccagacctgggccagatactttgtgaagttcctggatgcctatgct
gagcacaagttacagttctgggcagtgacagctgaaaatgagccttctgctgggctgttg
agtggataccccttccagtgcctgggcttcacccctgaacatcagcgagacttcattgcc
cgtgacctaggtcctaccctcgccaacagtactcaccacaatgtccgcctactcatgctg
gatgaccaacgcttgctgctgccccactgggcaaaggtggtactgacagacccagaagca
gctaaatatgttcatggcattgctgtacattggtacctggactttctggctccagccaaa
gccaccctaggggagacacaccgcctgttccccaacaccatgctctttgcctcagaggcc
tgtgtgggctccaagttctgggagcagagtgtgcggctaggctcctgggatcgagggatg
cagtacagccacagcatcatcacgaacctcctgtaccatgtggtcggctggaccgactgg
aaccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgtcgacagtccc
atcattgtagacatcaccaaggacacgttttacaaacagcccatgttctaccaccttggc
cacttcagcaagttcattcctgagggctcccagagagtggggctggttgccagtcagaag
aacgacctggacgcagtggcactgatgcatcccgatggctctgctgttgtggtcgtgcta
aaccgctcctctaaggatgtgcctcttaccatcaaggatcctgctgtgggcttcctggag
acaatctcacctggctactccattcacacctacctgtggcgtcgccagtga
5' End
3' End
NotesCDS of recoded gene was only given for the first 186bp (excluding the leader sequence) which is the only part of the gene that was codon optimized. The remaining part of the CDS was taken from the natural gene.
Expression VectorpPICZ-alpha-apPICZ-alpha-a
Assay MethodsSDS-PAGE, Northern BlotSDS-PAGE, Northern Blot
ResultsSignificant amount (3.7 activity)High increase (10 fold more)
Protein FunctionBreaks down membrane glycosphingolipids in cells.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimization based on the codon usage patterns of highly expressed P. pastoris genes, leading
to lower GC content and higher AT content. Gene was fused to a luiferase gene for reporting
purposes.
Publication Author(s)Sinclair, G.; Choy, F. Y.
Corresponding AuthorGraham Sinclair
Corresponding AddressDepartment of Biology, Centre for Biomedical Research, University of Victoria, P.O. Box 3020 STN CSC, BC, V8W 3N5, Victoria, Canada. grahams@uvic.ca
Publication Year2002
Publication TitleSynonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast, Pichia pastoris
AbstractThe lysosomal hydrolase glucocerebrosidase catalyzes the penultimate step in the breakdown of membrane glycosphingolipids. An inherited deficiency in this enzyme leads to the onset of Gaucher disease, the most common lysosomal storage disorder. Exogenous sources of this protein are required for biochemical and biophysical investigations and enzyme replacement therapy of Gaucher disease. Heterologous expression of glucocerebrosidase has been successful in mammalian and insect cell lines and although its use in enzyme replacement therapy of Gaucher disease has proven efficacious, current production levels limit the availability of the enzyme. Initial attempts to express human glucocerebrosidase using the methylotrophic yeast Pichia pastoris had limited success, despite significant levels of transcription. Using fragments of the glucocerebrosidase cDNA fused to the luciferase cDNA as a translational read-through reporter, the impact of synonymous codon usage bias on protein expression in P. pastoris was examined. A table of preferred codons was determined for P. pastoris and the codon usage of a 186-bp fragment of the glucocerebrosidase gene was optimized to that of the P. pastoris preferred set. A second construct with altered G+C content but no codon optimization was created for comparison. While the native glucocerebrosidase coding region limited luciferase activity to baseline levels, the codon optimized and G+C altered constructs increased luciferase activity 10.6- and 7.5-fold, respectively. Optimized G+C content, regardless of corresponding codon optimization, appears to be the major contributor to increased translational efficiency in this heterologous expression host.
JournalProtein Expr Purif. 26(1): 96-105.
SummaryPichia pastoris was transformed with a recoded version of the GCB gene, GBOPT, in order to increase expression of the glucocerebrosidase enzyme. For this, the GCB gene was codon optimized based on the codon usage data of highly expressed genes in P. pastoris which yielded GBOPT. As expected the recoding allowed for a higher yield, 10 fold more in fact. From this it can be concluded that the recoding was a success since it was able to create a much higher yield of protein.
CommentsCDS of recoded gene was only given for the first 186bp (excluding the leader sequence) which is the only part of the gene that was codon optimized. The remaining part of the CDS was taken from the natural gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=539
PubMed ID12356476
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site