Synthetic Gene DataBase
 

Synthetic Gene 158


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID146158
GenBank AccessionAY588945
GenBank GI55792399
Gene Namegaggag
Gene Length (bp)15330
SpeciesSimian immunodeficiency virusMus musculus
StrainsSIVmac239Hela cells, mouse spleen cells
CDSatgggcgtgagaaactccgtcttgtcagggaagaaagcagatgaattagaaaaaattagg
ctacgacccaacggaaagaaaaagtacatgttgaagcatgtagtatgggcagcaaatgaa
ttagatagatttggattagcagaaagcctgttggagaacaaagaaggatgtcaaaaaata
ctttcggtcttagctccattagtgccaacaggctcagaaaatttaaaaagcctttataat
actgtctgcgtcatctggtgcattcacgcagaagagaaagtgaaacacactgaggaagca
aaacagatagtgcagagacacctagtggtggaaacaggaacaacagaaactatgccaaaa
acaagtagaccaacagcaccatctagcggcagaggaggaaattacccagtacaacaaata
ggtggtaactatgtccacctgccattaagcccgagaacattaaatgcctgggtaaaattg
atagaggaaaagaaatttggagcagaagtagtgccaggatttcaggcactgtcagaaggt
tgcaccccctatgacattaatcagatgttaaattgtgtgggagaccatcaagcggctatg
cagattatcagagatattataaacgaggaggctgcagattgggacttgcagcacccacaa
ccagctccacaacaaggacaacttagggagccgtcaggatcagatattgcaggaacaact
agttcagtagatgaacaaatccagtggatgtacagacaacagaaccccataccagtaggc
aacatttacaggagatggatccaactggggttgcaaaaatgtgtcagaatgtataaccca
acaaacattctagatgtaaaacaagggccaaaagagccatttcagagctatgtagacagg
ttctacaaaagtttaagagcagaacagacagatgcagcagtaaagaattggatgactcaa
acactgctgattcaaaatgctaacccagattgcaagctagtgctgaaggggctgggtgtg
aatcccaccctagaagaaatgctgacggcttgtcaaggagtaggggggccgggacagaag
gctagattaatggcagaagccctgaaagaggccctcgcaccagtgccaatcccttttgca
gcagcccaacagaggggaccaagaaagccaattaagtgttggaattgtgggaaagaggga
cactctgcaaggcaatgcagagccccaagaagacagggatgctggaaatgtggaaaaatg
gaccatgttatggccaaatgcccagacagacaggcgggttttttaggccttggtccatgg
ggaaagaagccccgcaatttccccatggctcaagtgcatcaggggctgatgccaactgct
cccccagaggacccagctgtggatctgctaaagaactacatgcagttgggcaagcagcag
agagaaaagcagagagaaagcagagagaagccttacaaggaggtgacagaggatttgctg
cacctcaattctctctttggaggagaccagtag
5' End
3' End
NotesNatural gene was not used in the experiment.COntacted authors for the sequence on 1/23/06.
Expression VectorpCAGGS
Assay MethodsELISPOTs, Intracellular cytokine (ICC) staining and Flow cytometry analysis.
ResultsSignificant expression.
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons optimized for mammalian usage.
Publication Author(s)Bu, Z.; Ye, L.; Compans, R. W.; Yang, C.
Corresponding AuthorChinglai Yang
Corresponding AddressDepartment of Microbiology and Immunology, Emory University School of Medicine, 1510 Clifton Road, Room 3086, Rollins Research Center, Atlanta, GA 30322, USA.
Publication Year2003
Publication TitleEnhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins
AbstractCodon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines.
JournalVirology. 309(2): 272-81.
SummaryTo get higher levels of protein expression and induce stronger immune responses, the authors synthesized the wild type SIVmac239 Gag, the mutant Gag-M and the 3C/Gag chimeric proteins with codons optimized for mammalian usage. Then, their expression levels and immunogenicity in mice are evaluated. According to the experimental results, all of the codon-optimized wild type Gag, mutant Gag, and Chimeric Gag expressed similar levels but DNA vectors encoding mutant or chimeric Gag induced higher levels of anti-SIV Gag CD4T cell responses than DNA vector encoding wild type SIV Gag.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=642
PubMed ID12758174
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site