Synthetic Gene DataBase
 

Synthetic Gene 160


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID148160
GenBank AccessionY09787
GenBank GI2414155
Gene NamecryIA(c)Ubi-cryIA(c)
Gene Length (bp)18570
SpeciesBacillus thuringiensisOryza sativa
StrainsHD-73Leaves
CDSatggacaacaacccaaacatcaacgaatgcattccatacaactgcttgagtaacccagaa
gttgaagtacttggtggagaacgcattgaaaccggttacactcccatcgacatctccttg
tccttgacacagtttctgctcagcgagttcgtgccaggtgctgggttcgttctcggacta
gttgacatcatctggggtatctttggtccatctcaatgggatgcattcctggtgcaaatt
gagcagttgatcaaccagaggatcgaagagttcgccaggaaccaggccatctctaggttg
gaaggattgagcaatctctaccaaatctatgcagagagcttcagagagtgggaagccgat
cctactaacccagctctccgcgaggaaatgcgtattcaattcaacgacatgaacagcgcc
ttgaccacagctatcccattgttcgcagtccagaactaccaagttcctctcttgtccgtg
tacgttcaagcagctaatcttcacctcagcgtgcttcgagacgttagcgtgtttgggcaa
aggtggggattcgatgctgcaaccatcaatagccgttacaacgaccttactaggctgatt
ggaaactacaccgaccacgctgttcgttggtacaacactggcttggagcgtgtctggggt
cctgattctagagattggattagatacaaccagttcaggagagaattgaccctcacagtt
ttggacattgtgtctctcttcccgaactatgactccagaacctaccctatccgtacagtg
tcccaacttaccagagaaatctatactaacccagttcttgagaacttcgacggtagcttc
cgtggttctgcccaaggtatcgaaggctccatcaggagcccacacttgatggacatcttg
aacagcataactatctacaccgatgctcacagaggagagtattactggtctggacaccag
atcatggcctctccagttggattcagcgggcccgagtttacctttcctctctatggaact
atgggaaacgccgctccacaacaacgtatcgttgctcaactaggtcagggtgtctacaga
accttgtcttccaccttgtacagaagacccttcaatatcggtatcaacaaccagcaactt
tccgttcttgacggaacagagttcgcctatggaacctcttctaacttgccatccgctgtt
tacagaaagagcggaaccgttgattccttggacgaaatcccaccacagaacaacaatgtg
ccacccaggcaaggattctcccacaggttgagccacgtgtccatgttccgttccggattc
agcaacagttccgtgagcatcatcagagctcctatgttctcttggattcaccgttctgcc
gaattcaacaatattatcgcatctgatagtattactcaaatccctgccgtgaagggaaac
ttccttttcaatggaagcgttatcagcggaccaggatttactggcggagaccttgtgaga
cttaatagctctggcaacaacattcagaatagaggctacatcgaggttcctatccacttc
ccatccacatctactagatatagagttagggttagatacgcctctgtgaccccaatccac
cttaacgtgaactggggcaattcatctatcttctccaacaccgttccagctactgctacc
tcacttgataatcttcaatccagcgattttggttacttcgaaagtgccaacgcattcact
tcttcattgggcaacatcgtgggtgttaggaatttcagcggtactgcaggagtgatcatt
gacagattcgagtttattcctgttactgccactcttgaggctgagtacaatctttaa
5' End
3' End
NotesThe CDS for the natural gene was taken from the NCBI database. No tests were conducted on any unaltered natural genes.The CDS for the recoded gene was not provided and could not be obtained.
Expression VectorpKGH4
Assay MethodsNorthern Blot, Southern Blot, ELISA
ResultsBarely detectable to significant amounts (Ranging from .01% to 3% soluble protein, with most having between .2% and 2% soluble protein)
Protein FunctionInsecticidal for rice pests
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons from the natural gene were modified based on the codon usage patterns of highly expressed
rice plants. In addition, a maize ubiquitin promoter, a CaMV35S promoter, and a Bp10 promoter were
fused to the gene.
Publication Author(s)Cheng, X.; Sardana, R.; Kaplan, H.; Altosaar, I.
Corresponding AuthorIllimar Altosaar
Corresponding AddressAgricultural Biotechnology Laboratories, Department of Biochemistry, Faculty of Medicine, University of Ottawa, 40 Marie Curie Private, Ottawa, Ontario, K1N 6N5 Canada.
Publication Year1998
Publication TitleAgrobacterium-transformed rice plants expressing synthetic cryIA(b) and cryIA(c) genes are highly toxic to striped stem borer and yellow stem borer
AbstractOver 2,600 transgenic rice plants in nine strains were regenerated from >500 independently selected hygromycin-resistant calli after Agrobacterium-mediated transformation. The plants were transformed with fully modified (plant codon optimized) versions of two synthetic cryIA(b) and cryIA(c) coding sequences from Bacillus thuringiensis as well as the hph and gus genes, coding for hygromycin phosphotransferase and beta-glucuronidase, respectively. These sequences were placed under control of the maize ubiquitin promoter, the CaMV35S promoter, and the Brassica Bp10 gene promoter to achieve high and tissue-specific expression of the lepidopteran-specific delta-endotoxins. The integration, expression, and inheritance of these genes were demonstrated in R0 and R1 generations by Southern, Northern, and Western analyses and by other techniques. Accumulation of high levels (up to 3% of soluble proteins) of CryIA(b) and CryIA(c) proteins was detected in R0 plants. Bioassays with R1 transgenic plants indicated that the transgenic plants were highly toxic to two major rice insect pests, striped stem borer (Chilo suppressalis) and yellow stem borer (Scirpophaga incertulas), with mortalities of 97-100% within 5 days after infestation, thus offering a potential for effective insect resistance in transgenic rice plants.
JournalProc Natl Acad Sci U S A. 95(6): 2767-72.
SummaryRice (Oryza sativa) was transformed with Ubi-cryIA(b) and Ubi-cryIA(c), recoded versions of the cryIA(b) and cryIA(c) genes respectively, in order to increase the expression of protein in rice plants. Both natural genes were codon optimized based on the codon usage patterns of rice platns in order to attain the recoded genes, Ubi-cryIA(b) and Ubi-cryIA(c). As expected, Ubi-cryIA(b) and Ubi-cryIA(c) plants were able to produce barely detectable to significant amounts of their respective proteins. Overall, the recoding can be considered fairly successful, since it was able to create a higher yield of protein, but not in all plants.
CommentsThe CDS for the recoded gene and natural gene was not provided. The CDS for the natural gene was taken from the NCBI database and the recoded gene CDS could not be obtained. No tests were conducted on any unaltered natural genes.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=567
PubMed ID9501164
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site