Synthetic Gene DataBase
 

Synthetic Gene 161


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID149161
GenBank AccessionU39362AY641097
GenBank GI940979749359139
Gene Nameenvenv
Gene Length (bp)25622565
Specieshuman immunodeficiency virus (HIV1)Mus musculus
Strains89.6mouse spleen cells
CDSatgagagtgaaggagatcaggaagaattggcagcacttgagagggggcatcttgctcctt
gggatgttgatgatctgtagtgctgcaaaagaaaaaacgtgggtcacaatctattatggg
gtacctgtgtggagagaagcaaccaccactctattttgtgcatcagatgctaaagcctat
gatacagaggtacataatgtttgggccacacatgcctgtgtacccacagaccccaaccca
caagaagtagtattgggaaatgtgacagaaaattttaacatgtggaaaaataacatggta
gatcagatgcatgaggatataatcagtttatgggatgaaagcctaaagccatgtgtaaaa
ttaaccccactctgtgttactttaaattgcactaatttgaatatcactaagaatactact
aatcccactagtagcagctggggaatgatggagaaaggagaaataaaaaattgctctttc
tatatcaccacaagcataagaaataaggtaaagaaagaatatgcactttttaatagactt
gatgtagtaccaatagaaaatactaataatactaagtataggttaataagttgtaacacc
tcagtcattacacaggcctgtccaaaggtatcctttcagccaattcccatacattattgt
gtcccggctgggtttgcgatgctaaagtgtaacaataagacattcaatggatcaggacca
tgcacaaatgtcagcacagtacaatgtacacatggaattaggccagtggtgtcaactcaa
ctgctgttaaatggcagtctagcagaagaagacatagtaattagatctgaaaatttcaca
gacaatgctaaaaccataatagtacagctaaatgaatctgtagtaattaattgtacaaga
cccaacaacaatacaagaagaaggttatctataggaccagggagagcattttatgcaaga
agaaacataataggagatataagacaagcacattgtaacattagtagagcaaaatggaat
aacactttacaacagatagttataaaattaagagaaaaatttaggaataaaacaatagcc
tttaatcaatcctcaggaggggacccagaaattgtaatgcacagttttaattgtggaggg
gaatttttctactgtaatacagcacaactgtttaatagtacttggaatgttactggaggg
acaaatggcactgaaggaaatgacataatcacactccaatgcagaataaaacaaattata
aatatgtggcagaaagtaggaaaagcaatgtatgcccctcccatcacaggacaaattaga
tgttcatcaaatattacagggctgctactaacaagagatggaggtaatagtactgagact
gagactgagatcttcagacctggaggaggagatatgagggacaattggagaagtgaatta
tataaatataaagtagtaagaattgaaccaataggagtagcacccaccagggcaaagaga
agaacagtgcaaagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttg
ggagcagcaggaagcactatgggcgcagcgtcagtgacgctgacggtacaggccaggcta
ttattgtctggtatagtgcagcagcagaacaatctgctgagggctattgaggcgcaacag
catatgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctctg
gaaagatacctaagggatcaacagctcatgggaatttggggttgctctggaaaactcatt
tgcaccacttctgtgccttggaatgttagttggagtaataaatctgtggatgatatttgg
aataacatgacctggatggagtgggaaagagaaattgacaattacacagactatatatat
gacttacttgaaaaatcgcaaacccaacaagaaaagaatgaaaaagaattattggaattg
gataaatgggcaagtttgtggaattggtttgacataacaaactggctgtggtatataaga
ttattcataatgatagtaggaggcttgataggtttaagaatagtttttgctgtactttct
atagtaaatagagttaggcagggatattcaccattatcgtttcagaccctcctcccagcc
tcgaggggacccgacaggcccgaaggaacagaagaagaaggtggagagagagacagagac
agatccggtccattagtgaacggattcttggcacttttctgggtcgatttgaggaacctg
tgcctcttcctctaccacctcttgagaaacttactcttgattgtaacgaggattgtggaa
cttctgggacgcagggggtgggaagccctcaaatattggtggaatctcctgcaatattgg
agccaggaactaaagaatagtgctgttagcttgctcaacgccacagccatagcagtagct
gaggggacagatagggttataaaaatagtacaaagagcttgtagagctattcgcaacata
cctacaagaatcagacagggcttggaaagggctttgctataa
atgcgcgtgaaggagaagtaccagcacctgtggcgctggggctggcgctggggcaccatg
ctgctgggcatgctgatgatctgcagcgccaccgagaagctgtgggtgaccgtgtactac
ggcgtgcccgtgtggcgcgaggccaccaccaccctgttctgcgccagcgacgccaaggcc
tacgacaccgaggtgcacaacgtgtgggccacccacgcctgcgtgcccaccgaccccaac
ccccaggaggtggtgctgggcaacgtgaccgagaacttcaacatgtggaagaacaacatg
gtggaccagatgcacgaggacatcatcagcctgtgggacgagagcctgaagccctgcgtg
aagctgacccccctgtgcgtgaccctgaactgcaccaacctgaacatcaccaagaacacc
accaaccccaccagcagcagctggggcatgatggagaagggcgagatcaagaactgcagc
ttctacatcaccaccagcatccgcaacaaggtgaagaaggagtacgccctgttcaaccgc
ctggacgtggtgcccatcgagaacaccaacaacaccaagtaccgcctgatcagctgcaac
accagcgtgatcacccaggcctgccccaaggtgagcttccagcccatccccatccactac
tgcgtgcccgccggcttcgccatgctgaagtgcaacaacaagaccttcaacggcagcggc
ccctgcaccaacgtgagcaccgtgcagtgcacccacggcatccgccccgtggtgagcacc
cagctgctgctgaacggcagcctggccgaggaggacatcgtgatccgcagcgagaacttc
accgacaacgccaagaccatcatcgtgcagctgaacgagagcgtggtgatcaactgcacc
cgccccaacaacaacacccgccgccgcctgagcatcggccccggccgcgccttctacgcc
cgccgcaacatcatcggcgacatccgccaggcccactgcaacatcagccgcgccaagtgg
aacaacaccctgcagcagatcgtgatcaagctgcgcgagaagttccgcaacaagaccatc
gccttcaaccagagcagcggcggcgaccccgagatcgtgatgcacagcttcaactgcggc
ggcgagttcttctactgcaacaccgcccagctgttcaacagcacctggaacgtgaccggc
ggcaccaacggcaccgagggcaacgacatcatcaccctgcagtgccgcatcaagcagatc
atcaacatgtggcagaaggtgggcaaggccatgtacgccccccccatcaccggccagatc
cgctgcagcagcaacatcaccggcctgctgctgacccgcgacggcggcaacagcaccgag
accgagaccgagatcttccgccccggcggcggcgacatgcgcgacaactggcgcagcgag
ctgtacaagtacaaggtggtgcgcatcgagcccatcggcgtggcccccacccgcgccaag
cgccgcaccgtgcagcgcgagaagcgcgccgtgggcatcggcgccgtgttcctgggcttc
ctgggcgccgccggcagcaccatgggcgccgccagcgtgaccctgaccgtgcaggcccgc
ctgctgctgagcggcatcgtgcagcagcagaacaacctgctgcgcgccatcgaggcccag
cagcacatgctgcagctgaccgtgtggggcatcaagcagctgcaggcccgcgtgctggcc
ctggagcgctacctgcgcgaccagcagctgatgggcatctggggctgcagcggcaagctg
atctgcaccaccagcgtgccctggaacgtgagctggagcaacaagagcgtggacgacatc
tggaacaacatgacctggatggagtgggagcgcgagatcgacaactacaccgactacatc
tacgacctgctggagaagagccagacccagcaggagaagaacgagaaggagctgctggag
ctggacaagtgggccagcctgtggaactggttcgacatcaccaactggctgtggtacatc
cgcctgttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctg
agcatcgtgaaccgcgtgcgccagggctacagccccctgagcttccagaccctgctgccc
gccagccgcggccccgaccgccccgagggcaccgaggaggagggcggcgagcgcgaccgc
gaccgcagcggccccctggtgaacggcagcctggccctgatctgggacgacctgcgcagc
ctgtgcctgttcagctaccaccgcctgcgcgacctgctgctgatcgtgacccgcatcgtg
gagctgctgggccgccgcggctgggaggccctgaagtactggtggaacctgctgcagtac
tggagccaggagctgaagaacagcgccgtgagcctgctgaacgccaccgccatcgccgtg
gccgagggcaccgaccgcgtgatcgaggtggtgcagggcgcctgccgcgccatccgccac
atcccccgccgcatccgccagggcctggagcgcatcctgctgtaa
5' End
3' End
NotesNatural gene was not used in the experiment. GenBank accesion was not provided by the authors. Submitted U39362 for a record.HIV-1 89.6 Env; optimized codon usage.
Expression Vector
Assay MethodsIntracellular cytokine staining and Flow cytometry
ResultsPositive.
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodcodons optimized for mammalian cell usage.
Publication Author(s)Yao, Q.; Bu, Z.; Vzorov, A.; Yang, C.; Compans, R. W.
Corresponding AuthorRichard W.Compans
Corresponding AddressDepartment of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322, USA.
Publication Year2003
Publication TitleVirus-like particle and DNA-based candidate AIDS vaccines
AbstractBoth humoral and cellular immune responses are critical for the control of HIV infection and replication. We have established systems for production of HIV and SIV virus-like particles containing high levels of viral Env proteins using the baculovirus expression system. Evaluation of immunogenicity showed that immunization with virus-like particles induced both cellular and neutralizing antibody responses. Furthermore, mucosal administration of virus-like particles effectively induced both mucosal and systemic immune responses. These results indicate that virus-like particles consisting of HIV structural proteins are an attractive vaccine platform for eliciting anti-viral immune responses, especially neutralizing antibody responses. We have also synthesized codon-optimized genes for HIV Env proteins and evaluated their immunogenicity. Combinations of virus-like particle and DNA-based vaccination are promising for inducing strong cellular and neutralizing antibody responses against HIV.
JournalVaccine. 21(8-Jul): 638-43.
SummaryTo develop DNA vaccines for enhancing cellular immune responses against HIV, codon-optimized genes for HIV89.6 Env protein were constructed. Codons were optimized for mammalian cell usage. BALB/c mice were immunized with DNA constructs encoding gp120, gp140, or gp160tr respectively and immunogenicity were evaluated. Percentage of CD8 cells expressing IFN gamma by gp120, gp140, and gp160 vaccines were <1%, ~1.3%, and ~3.3 % respectively.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=636
PubMed ID12531332
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site