Synthetic Gene DataBase
 

Synthetic Gene 162


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID150162
GenBank AccessionU83981.1
GenBank GI3258617
Gene NameGADD34GADD34
Gene Length (bp)2025300
SpeciesHomo SapiensEscherichia coli
StrainsNot mentionedBL21Star (DE3)
CDSatggccccaggccaagcaccccatcaggctaccccgtggagggatgcccaccctttcttc
ctcctgtccccagtgatgggcctcctcagccgcgcctggagccgcctgaggggcctggga
cctctagagccctggctggtggaagcagtaaaaggagcagctctggtagaagctggcctg
gagggagaagctaggactcctctggcaatcccccataccccttggggcagacgccctgaa
gaggaggctgaagacagtggaggccctggagaggacagagaaacactggggctgaaaacc
agcagttcccttcctgaagcctggggacttttggatgatgatgatggcatgtatggtgag
cgagaggcaaccagtgtccctagagggcagggaagtcaatttgcagatggccagcgtgct
cccctgtctcccagccttctgataaggacactgcaaggttctgataagaacccaggggag
gagaaagccgaggaagagggagttgctgaagaggagggagttaacaagttctcttatcca
ccatcacaccgggagtgttgtccagccgtggaggaggaggacgatgaagaagctgtaaag
aaagaagctcacagaacctctacttctgccttgtctccaggatccaagcccagcacttgg
gtgtcttgcccaggggaggaagagaatcaagccacggaggataaaagaacagaaagaagt
aaaggagccaggaagacctccgtgtccccccgatcttcaggctccgaccccaggtcctgg
gagtatcgttcaggagaggcgtccgaggagaaggaggaaaaggcacacaaagaaactggg
aaaggagaagctgccccagggccgcaatcctcagccccagcccagaggccccagctcaag
tcctggtggtgccaacccagtgatgaagaggagggtgaggtcaaggctttgggggcagct
gagaaggatggagaagctgagtgtcctccctgcatccccccaccaagtgccttcctgaag
gcctgggtgtattggccaggagaggacacagaggaagaggaagatgaggaagaagatgag
gacagtgactctggatcagatgaggaagagggagaagctgaggcttcctcttccactcct
gctacaggtgtcttcttgaagtcctgggtctatcagccaggagaggacacagaggaggag
gaagatgaggacagtgatacaggatcagccgaggatgaaagagaagctgagacttctgct
tccacaccccctgcaagtgctttcttgaaggcctgggtgtatcggccaggagaggacacg
gaggaggaggaagatgaggatgtggatagtgaggataaggaagatgattcagaagcagcc
ttgggagaagctgagtcagacccacatccctcccacccggaccagagggcccacttcagg
ggctggggatatcgacctggaaaagagacagaggaagaggaagctgctgaggactgggga
gaagctgagccctgccccttccgagtggccatctatgtacctggagagaagccaccgcct
ccctgggctcctcctaggctgcccctccgactgcaaaggcggctcaagcgcccagaaacc
cctactcatgatccggaccctgagactcccctaaaggccagaaaggtgcgcttctccgag
aaggtcactgtccatttcctggctgtctgggcagggccggcccaggccgcccgccagggc
ccctgggagcagcttgctcgggatcgcagccgcttcgcacgccgcatcacccaggcccag
gaggagctgagcccctgcctcacccctgctgcccgggccagagcctgggcacgcctcagg
aacccacctttagcccccatccctgccctcacccagaccttgccttcctcctctgtccct
tcgtccccagtccagaccacgcccttgagccaagctgtggccacaccttcccgctcgtct
gctgctgcagcggctgccctggacctcagtgggaggcgtggctga
cgtcgtctgaaacgtccggaaaccccgacccacgacccggacccggaaaccccgctgaaa
gcgcgtaaagttcgtttctctgaaaaagttaccgttcacttcctggcggtttgggcgggt
ccggcgcaggcggcgcgtcagggtccgtgggaacagctggcgcgtgaccgttctcgtttc
gcgcgtcgtatcacccaggcgcaggaagaactgtctccgtgcctgaccccggcggcgcgt
gcgcgtgcgtgggcgcgtctgcgtaacccgccgctggcgccgatcccggcgctgacccag
5' Endgaatcaagtaaaacatatgaggcggctcaagcgcccgaatcaagtaaaacatatgaggcggctcaagcgccc
3' Endatattaggatccttactgggtgagggcagggaatattaggatccttactgggtgagggcaggga
Notes
Expression VectorPET21aPET21a
Assay MethodsNuPAGENuPAGE
ResultsThere was no visible expression of the natural gene in any of three E. coli competent cells.High-level expressions of the synthetic GADD34 in both the BL21CodonPlus(DE3)-RP and BL21Star(DE3) were detected in inclusion bodies.
Protein FunctionHuman homolog of mouse MyD116 that is expresses in mylekoid leukemia cells induced to differentiate by interleukin
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe synthetic gene was designed using the DNAWorks program, but the recoding method was not
specified.
Publication Author(s)Yu, P.; Neamati, N.; Tarasov, S.; He, Q.; Sheikh, M. S.; Wang, Y. X.
Corresponding AuthorYun-Xing Wang
Corresponding AddressProtein-Nucleic Acid Interactions Section, Structural Biophysics Laboratory, NCI-Frederick, Frederick, Maryland 21702, USA.
Publication Year2004
Publication TitleCodon-optimized cloning, expression and characertization of the C-terminal region of human apoptotic protein GADD34 in Escherichia coli
AbstractThe human GADD34 (Growth Arrest and DNA Damage-inducible 34) is the product of an apoptosis- and DNA-damage-inducible gene. The C-terminus domain of GADD34 is highly homologous to HSV-1 gamma-1 34.5, HSV-2 and the African swine fever virus virulence-associated factor NL-S. Among these viral proteins, HSV-1 gamma 34.5 protein is known to prevent apoptosis of viral-infected cells. Because of the difficulty in expressing GADD34 protein or any of its fragments, including the C-terminus (amino acids 533-632) in E. coli, partially due to sub-optimal expression of eukaryotic codons in prokaryotic E. coli, we used a codon-optimized cloning scheme to construct the eukaryotic gene that codes for GADD34(533-632). We derived a novel PCR protocol to assemble 20 oligonucleotides into the synthetic GADD34(533-632) gene. The clear advantage of using this protocol is that the assembled gene is without the mutation and deletion that are usually of a major problem in constructing synthetic genes. The synthetic GADD34(533-632) gene was cloned, expressed, and purified in large quantity. We obtained approximately 50 mg of GADD34(533-632) protein per liter minimum-medium culture. To our knowledge, this is the first report of a large-scale production of the C-terminus of GADD34. The production and purification of GADD34(533-632) in large quantity are essential for structure determination as well as for understanding its interactions with other proteins such as phosphatase 1-alpha using NMR spectroscopy and other biophysical methods.
JournalCell Cycle. 3(1): 75-9.
SummaryThe goal of this experiment was to optimize the human GADD34 gene for expression in E. coli, so as to raise expression rates of the protein. The gene was optiized using the DNAWorks program, and then cloned into a PET21a vector and transformed into two types of E. coli cells, BL21Star(DE3) and BL21CodonPlus(DE3)-RP. The optimized gene showed high-level expression in each of these strains.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=660#660
PubMed ID14657671
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site