Synthetic Gene DataBase
 

Synthetic Gene 163


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID151163
GenBank AccessionBC104164.1
GenBank GI74355760
Gene NameIFN-alphaIFN-alpha
Gene Length (bp)805501
SpeciesHomo sapiensEscherichia coli
StrainsN/AJM109(DE3)
CDSggctcacccatttcaaccagtctagcagcatctgcaacatctacaatggccttgaccttt
gctttactggtggccctcctggtgctcagctgcaagtcaagctgctctgtgggctgtgat
ctgcctcaaacccacagcctgggtagcaggaggaccttgatgctcctggcacagatgagg
agaatctctcttttctcctgcttgaaggacagacatgactttggatttccccaggaggag
tttggcaaccagttccaaaaggctgaaaccatccctgtcctccatgagatgatccagcag
atcttcaatctcttcagcacaaaggactcatctgctgcttgggatgagaccctcctagac
aaattctacactgaactctaccagcagctgaatgacctggaagcctgtgtgatacagggg
gtgggggtgacagagactcccctgatgaaggaggactccattctggctgtgaggaaatac
ttccaaagaatcactctctatctgaaagagaagaaatacagcccttgtgcctgggaggtt
gtcagagcagaaatcatgagatctttttctttgtcaacaaacttgcaagaaagtttaaga
agtaaggaatgaaaactggttcaacatggaaatgattttcattgattcgtatgccagctc
acctttttatgatctgccatttcaaagactcatgtttctgctatgaccatgacacgattt
aaatcttttcaaatgtttttaggagtattaatcaacattgtattcagctcttaaggcact
agtcccttacagaggaccatgctga
atgtgtgatctgcctcaaacccacagcctgggtagcaggaggaccttgatgctcctggca
cagatgaggagaatctctcttttctcctgcttgaaggacagacatgactttggatttccc
caggaggagtttggcaaccagttccaaaaggctgaaaccatccctgtcctccatgagatg
atccagcagatcttcaatctcttcagcacaaaggactcatctgctgcttgggatgagacc
ctcctagacaaattctacactgaactctaccagcagctgaatgacctggaagcctgtgtg
atacagggggtgggggtgacagagactcccctgatgaaggaggactccattctggctgtg
aggaaatacttccaaagaatcactctctatctgaaagagaagaaatacagcccttgtgcc
tgggaggttgtcagagcagaaatcatgagatctttttctttgtcaacaaacttgcaagaa
agtttaagaagtaaggaataa
5' End
3' End
Notes
Expression VectorN/ApET-9a
Assay MethodsN/AWestern blot
ResultsThe natural gene was not expressed in this experiment, but prior studies have shown that it yields poorly when transformed into E. coli.The optimized gene resulted in a protein expression increase to 9.5-11.5 times that of the natural gene.
Protein FunctionKnown to display antiviral, antiproliferative, and immunomodulatory activities.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe first 23 amino acids in the natural protein were recoded in the recoded gene, to optimize
expression. The actual recoding method was not specified.
Publication Author(s)Valente, C. A.; Prazeres, D. M.; Cabral, J. M.; Monteiro, G. A.
Corresponding AuthorGabriel Monteiro
Corresponding AddressCentro de Engenharia Biologica e Quimica, Instituto Superior Tecnico, Av. Rovisco Pais, 1049-001 Lisbon, Portugal.
Publication Year2004
Publication TitleTranslational features of human alpha 2b interferon production in Escherichia coli
AbstractThe yield of human alpha 2b interferon in Escherichia coli was optimized by replacement of low-usage arginine codons located in the mRNA 5' end. The differences observed among the various gene variants suggest that codon usage, Shine-Dalgarno-like sequences, and mRNA secondary structure contribute to the performance of E. coli translation machinery.
JournalAppl Environ Microbiol. 70(8): 5033-6.
SummaryThe goal of this study was to optimize expression of human alpha-2b interferon in E. coli. The first 23 amino acids in the gene sequence were optimized for E. coli expression, and inserted into a pET-9a expression vector, which was transformed into JM109(DE3) cells. These cells showed an increase in protein product between 9.5 and 11.5 times the natural gene product.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=663#663
PubMed ID15294846
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site