Synthetic Gene DataBase
 

Synthetic Gene 164


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID152164
GenBank AccessionJ01342M17195
GenBank GI172143209594
Gene NamePGK1pgk10
Gene Length (bp)1251498
SpeciesSaccharomyces cerevisiaeSaccharomyces cerevisiae
Strains20B-12
CDSatgtctttatcttcaaagttgtctgtccaagatttggacttgaaggacaagcgtgtcttc
atcagagttgacttcaacgtcccattggacggtaagaagatcacttctaaccaaagaatt
gttgctgctttgccaaccatcaagtacgttttggaacaccacccaagatacgttgtcttg
gcttctcacttgggtagaccaaacggtgaaagaaacgaaaaatactctttggctccagtt
gctaaggaattgcaatcattgttgggtaaggatgtcaccttcttgaacgactgtgtcggt
ccagaagttgaagccgctgtcaaggcttctgccccaggttccgttattttgttggaaaac
ttgcgttaccacatcgaagaagaaggttccagaaaggtcgatggtcaaaaggtcaaggct
tccaaggaagatgttcaaaagttcagacacgaattgagctctttggctgatgtttacatc
aacgatgccttcggtaccgctcacagagctcactcttctatggtcggtttcgacttgcca
caacgtgctgccggtttcttgttggaaaaggaattgaagtacttcggtaaggctttggag
aacccaaccagaccattcttggccatcttaggtggtgccaaggttgctgacaagattcaa
ttgattgacaacttgttggacaaggtcgactctatcatcattggtggtggtatggctttc
accttcaagaaggttttggaaaacactgaaatcggtgactccatcttcgacaaggctggt
gctgaaatcgttccaaagttgatggaaaaggccaaggccaagggtgtcgaagtcgtcttg
ccagtcgacttcatcattgctgatgctttctctgctgatgccaacaccaagactgtcact
gacaaggaaggtattccagctggctggcaagggttggacaatggtccagaatctagaaag
ttgtttgctgctactgttgcaaaggctaagaccattgtctggaacggtccaccaggtgtt
ttcgaattcgaaaagttcgctgctggtactaaggctttgttagacgaagttgtcaagagc
tctgctgctggtaacaccgtcatcattggtggtggtgacactgccactgtcgctaagaag
tacggtgtcactgacaagatctcccatgtctctactggtggtggtgcttctttggaatta
ttggaaggtaaggaattgccaggtgttgctttcttatccgaaaagaaataa
atgtcgctctcgtcgaaactctcggtgcaagatctcgatctcaaagataaacgggtattt
atacgggtagattttaatgtaccgctcgatggaaaaaaaataacgtcgaatcagcggata
gtagcggcgctcccgacgataaaatatgtactcgagcatcatccgcggtatgtagtactc
gcgtcgcatctcggtagaccgaatggagagcggaatgagaaatattcgctcgcgccggta
gcgaaagagctccagtcgctcctcggaaaagatgtaacgtttctcaatgattgcgtaggt
ccggaggtagaggcggcggtaaaagcgtcggcgccgggatcggtaatactcctcgagaat
ctccggtatcatatagaggaggagggatcgcggaaagtagatggacagaaagtaaaagcg
tcgaaagaggatgtacagaaatttcggcatgagctctcgtcgctcgcggatgtatatata
aatgatgcgtttggtacc
5' End
3' End
NotesThe recoded gene is the 5’ end which was the end that was codon modified and provided by the article and NBCI.
Expression VectorYEp9TYEp9T
Assay MethodsSDS-PAGE, Northern BlotSDS-PAGE, Northern Blot
ResultsSignificant amount (31% of total protein)Significant decrease (10 fold less)
Protein FunctionHelps catalyze phosphate transfer for conversion of ADP to ATP.
Recoding PurposeTo determine if codon usage is correlated to expression level.
Synthesized ByAuthors
Recoding MethodMajor codons of the natural gene were all replaced with synonymous minor codons.
Publication Author(s)Hoekema, A.; Kastelein, R. A.; Vasser, M.; de Boer, H. A.
Corresponding AuthorHerman A. De Boer
Corresponding AddressDepartment of Cell Genetics, Genentech, Inc., South San Francisco, California 94080.
Publication Year1987
Publication TitleCodon replacement in the PGK1 gene of Saccharomyces cerevisiae: experimental approach to study the role of biased codon usage in gene expression
AbstractThe coding sequences of genes in the yeast Saccharomyces cerevisiae show a preference for 25 of the 61 possible coding triplets. The degree of this biased codon usage in each gene is positively correlated to its expression level. Highly expressed genes use these 25 major codons almost exclusively. As an experimental approach to studying biased codon usage and its possible role in modulating gene expression, systematic codon replacements were carried out in the highly expressed PGK1 gene. The expression of phosphoglycerate kinase (PGK) was studied both on a high-copy-number plasmid and as a single copy gene integrated into the chromosome. Replacing an increasing number (up to 39% of all codons) of major codons with synonymous minor ones at the 5' end of the coding sequence caused a dramatic decline of the expression level. The PGK protein levels dropped 10-fold. The steady-state mRNA levels also declined, but to a lesser extent (threefold). Our data indicate that this reduction in mRNA levels was due to destabilization caused by impaired translation elongation at the minor codons. By preventing translation of the PGK mRNAs by the introduction of a stop codon 3' and adjacent to the start codon, the steady-state mRNA levels decreased dramatically. We conclude that efficient mRNA translation is required for maintaining mRNA stability in S. cerevisiae. These findings have important implications for the study of the expression of heterologous genes in yeast cells.
JournalMol Cell Biol. 7(8): 2914-24.
SummaryYeast (Saccharomyces cerevisiae) was transformed with a recoded version of the PGK1 gene, pgk10, in order to study the correlation of codon usage and expression of protein. To attain pgk10, the naturally occurring PGK1 gene had its major codons replaced with synonymous minor codons. pgk10 transformed yeast had a much lower expression of protein than the natural gene. This leads to the conclusion that codon usage is directly related to expression of protein and makes the study successful.
CommentsThe recoded gene is the 5’ end which was the end that was codon modified and provided by the article and NBCI. This study was done to study the effect of codon usage in genes.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=547
PubMed ID2823108
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site