Synthetic Gene DataBase
 

Synthetic Gene 165


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID153165
GenBank AccessionK02718AY599018
GenBank GI33303147681308
Gene NameE7E7
Gene Length (bp)297906
Specieshuman papillomavirus (HPV-16)Mus musculus
StrainsType 16Renal carcinoma cells (Caki cells)
CDSatgcatggagatacacctacattgcatgaatatatgttagatttgcaaccagagacaact
gatctctactgttatgagcaattaaatgacagctcagaggaggaggatgaaatagatggt
ccagctggacaagcagaaccggacagagcccattacaatattgtaaccttttgttgcaag
tgtgactctacgcttcggttgtgcgtacaaagcacacacgtagacattcgtactttggaa
gacctgttaatgggcacactaggaattgtgtgccccatctgttctcagaaaccataa
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
tttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
tcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcctcaacaaccagcacgggacca
tgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtacc
aaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtat
tgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttt
tgtctttgggtatacattgatatcgaggaggacgagatcgacggccccgccggccaggcc
gagcccgaccgcgcccactacaacatcgtgaccttctgctgcaagtgcgactccaccctg
cgcctgtgcgtgcagagcacccacgtggacatccgcaccttggaggacctgctgatgggc
accctgggcatcgtgtgccccatctgcagccagaagcccgactacaaggacgacgacgac
aagtaa
5' End
3' End
NotesGenBank Accession was not provided by the authors. The sequence shown here is E7 ORF from 544 to 858; putative.
Expression VectorpcDNA3.1+pcDNA3
Assay MethodsWestern Blot, ELISA, IFN-gamma, t-test, Chi-square test.Western Blot, ELISA,Tumor prptection assay, IFN-gamma, t-test, Chi-square test.
ResultsLowSignificant increased.
Protein Functiontransmembrane protein, immunogenic protein.
Recoding PurposeTo improve expression
Synthesized ByCid-Arregui,A., Juarez,V. and zur Hausen,H.
Recoding MethodApply codons that are found preferentially in highly expressed human genes
Publication Author(s)Kim MS, Sin JI.
Corresponding AuthorDr.J.-I.Sin
Corresponding AddressDepartment of Obstetrics and Gynaecology, School of Medicine, Catholic Universit of Daegu, Namgu, Daegu, Korea.
Publication Year2005
Publication TitleBoth antigen optimization and lysosomal targeting are required for enhanced anti-tumour protective immunity in a human papillomavirus E7-expressing animal tumour model.
AbstractDNA immunization is a new approach for cancer immune therapy. In this study, we constructed human papillomavirus (HPV) 16 E7 expression vector cassettes and then compared the abilities of these constructs to induce antitumour protection. Lysosome-targeted E7 antigens, and to a lesser degree signal sequence-conjugated and transmembrane region sequence-conjugated E7 antigens in a DNA form, displayed tumour protection significantly higher than wild-type E7 antigens. This enhanced tumour protection was mediated by CD8+ cytotoxic T lymphocytes (CTL), as determined by in vivo T-cell depletion and in vitro interferon-gamma (IFN-gamma) production. Subsequent co-injection with interleukin-12-expressing cDNA showed insignificantly enhanced antitumour protection. However, E7 codon optimization plus lysosomal targeting resulted in a dramatic enhancement in antitumour protection both prophylactically and therapeutically through augmentation of the E7-specific CTL population, compared to either one of them alone. However, wild-type or codonoptimized E7 antigens without intracellular targeting displayed no protection against tumour challenge. Thus, these data suggest that antigen codon optimization plus lysosomal targeting strategy could be important in crafting more efficacious E7 DNA vaccines for tumour protection.
Journal Immunology. 116(): 255-266.
SummaryTo test for the abilities to induce protective immunity against TC-1 tumor cells, different E7 DNA vaccine cassettes were constructed. Codon-optimized E7 genes were used in places of wild type to get higher level of E7 protein expression. Codon-optimized E7 genes were constructed by using codons that are found preferentially in highly expressed human genes. Codon-optimized E7 antigens without intracellular targeting were resulted no protection against tumor challenge. However, Codon-optimized E7 genes in the lysosomal targeting vectors resulted in significant enhancement in antitumor protection through augmentation of CD8+ CTL populations.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=630
PubMed ID16162274
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site