Synthetic Gene DataBase
 

Synthetic Gene 166


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID154166
GenBank AccessionAJ851278AB071702
GenBank GI5572486215667632
Gene NameGFPmut3GFPmut3.2
Gene Length (bp)726726
SpeciesAequeora victoriaParamecium caudatum
Strains
CDSatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataagct
taatta
atgagaaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatggacacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttgacatatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacggaaactacaagacaagagctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctggaattacacatggaatggatgaattatacaaaagagct
ccatga
5' End
3' End
NotesSequence in NCBI database identical up until last four codons. The gene was synthesized Clontech and first mentioned in Cormack et al. 1996.
Expression VectorpTub-tel3 GFP2pTub-tel3 GFP3
Assay MethodsRT- PCR, Western blotRT- PCR, Western blot
ResultsNo GFP-related fluorescence detected. mRNA levels normalNo visible GFP on western blot. Relative mRNA levels lower than GFPmut3 and GFPmut3.3.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodTo improve the translation efficiency, 16 nucleotides were altered to preferable codons for P.
caudatum based on the codon usage database. http://www.kazusa.or.jp/codon/ The following codons were
considered highly rare: CGT GGG GCG CCC CAG AGC GGC CTG TCC TCG.
Publication Author(s)Takenaka, Y.; Haga, N.; Harumoto, T.; Matsuura, T.; Mitsui, Y.
Corresponding AuthorYouji Mitsui
Corresponding AddressInstitute of Molecular and Cell Biology (IMCB), National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, 305-8566, Ibaraki, Japan.
Publication Year2002
Publication TitleTransformation of Paramecium caudatum with a novel expression vector harboring codon-optimized GFP gene
AbstractWe have developed a novel expression vector, pTub-tel3, for transformation in Paramecium caudatum. The vector was constructed by cloning P. caudatum alpha-tubulin 5' and 3' non-coding regions. To examine transformation with the pTub-tel3 construct, we chose the green fluorescent protein (GFP) as a selection marker. When a linearized pTub-tel3 vector containing a GFP open reading frame was injected into the macronucleus, the GFP transcript was expressed in many clones whereas protein expression was detected only after extensive optimization of original GFP codons. GFP-derived fluorescence was distributed throughout the nuclei and cytoplasm except for contractile and food vacuoles. Upon continuous cell division, notable heterogeneity of GFP fluorescence among descendants from the same transformant has emerged. This expression vector can be applied to the analysis of protein trafficking and localization in addition to exogenous gene expression in P. caudatum.
JournalGene. 284(2-Jan): 233-40.
SummaryThe authors developed the pTub-tel3 expression vector understanding that there were no studies of exogenous gene express done in Paramecium caudatum. They used the GFP reporter gene in P. caudatum to tag the effective transformation of the vector. In pTub-tel3, α-tubulin 5’ and 3’ non-coding regions were used to flank the 5’ and 3’ regions of the GFP. The authors predicted that the α-tubulin promoter would be able to constitutively express the downstream GFP gene as the α-tubulin protein is abundantly and constitutively expressed in P. caudatum. GFPmut3 (Cormack et al. 1996) was used with the vector first but found to perform poorly in P. caudatum. GFPmut3 would be considered an enhanced GFP with intense fluorescence but it was not visibly expression in P. caudatum. Inefficient translation was probably caused by codon usage differences between jellyfish and paramecium. The authors referred the codon usage database at http://www.kazusa.or.jp/codon/ to improve translation by recoding the gene. GFPmut3.2 contains 16 bp changes and GFPmut3.3 contains 94. RT-PCR analysis of the GFPmut3, 3.2, and 3.3 showed mRNA levels were similar, with 3.2 having the lowest levels. Western analysis of the GFP protein showed a tremendous increase in the amount of expressed GFP due to the more aggressive translated GFPmut3.3 with 94 bp changes. There was no improvement in GFP expression with GFPmut3.2. Fluorescence microscopy showed fluorescence throughout the cytosol.
CommentsThe α-tubulin genes mentioned can be found at GenBank accession numbers X99489, X99490, M86723, Z11763.
Discussion
PubMed ID11891064
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site