Synthetic Gene DataBase
 

Synthetic Gene 169


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID156169
GenBank AccessionX83959U55763
GenBank GI6340081377914
Gene NameGFP (Green Fluorescent Protein)EGFP
Gene Length (bp)714798
SpeciesAequorea victoriaChinese hamster; African green monkey; Homo sapiens; Syrian hamster
StrainsCHO-K1; COS-1; HeLa; BHK-21
CDSatgagtaaaggagaagaacttttcactggagtggtcccagttcttgttgaattagatggc
gatgttaatgggcaaaaattctctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaattttatttgcactactgggaagctacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttctcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttac
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
atggaatacaactataactcacataatgtatacatcatgggagacaaaccaaagaatggc
atcaaagttaacttcaaaattagacacaacattaaagatggaagcgttcaattagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttccaaagatcccaacgaaaagagagatcacatgatcctt
cttgagtttgtaacagctgctaggattacacatggcatggatgaactatacaaa
atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggac
ggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctac
ggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccacc
ctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag
cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttc
ttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctg
gtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcac
aagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaac
ggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgcc
gaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccac
tacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtc
ctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtcc
ggactcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccggga
tccaccggatctagataa
5' End
3' End
NotesThe wild-type gene was not involved in this experiment as the purpose was to compare the sensitivity of the EGFP and β-gal reporter genesFor 5’ and 3’ UTR, refer to Genbank. The entire plasmid sequence is online. Recoding method taken from original publication regarding pEGFP-C1 (Yang 1996).
Expression VectorpEGFP-C1
Assay MethodsFluorescence microscopy
ResultsTransfection efficiencies were significantly and consistently higher than that of β-gal in all cell lines except BHK-21, where the efficiencies were the similar.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByClontech
Recoding MethodEGFP was recoded with 190 silent bp mutations, emulating preferred human codons.” Referenced Haas
1996.
Publication Author(s)Zhang, G.; Gurtu, V.; Kain, S. R.
Corresponding AuthorGuohong Zhang
Corresponding AddressClontech Laboratories, Inc., Palo Alto, California 94303, USA.
Publication Year1996
Publication TitleAn enhanced green fluorescent protein allows sensitive detection of gene transfer in mammalian cells
AbstractThe green fluorescent protein (GFP) from the jellyfish Aequorea victoria has become an important marker of gene expression. However, the sensitivity of wild-type GFP has been below that of standard reporter proteins, such as beta-galactosidase, which utilize enzymatic amplification. To improve the detection of GFP in transfected mammalian cells, we have constructed a unique GFP variant which contains chromophore mutations that make the protein 35 times brighter than wild-type GFP, and is codon-optimized for higher expression in mammalian cells. These changes in the GFP coding sequence provide an enhanced GFP (EGFP) that greatly increases the sensitivity of the reporter protein. We show that the EGFP expression vector delivered into mammalian cells gives rise to bright fluorescence that is readily detectable following a 16-24 hr transfection interval. Visual detection of transfected cells with EGFP appears to be more sensitive than equivalent measurements with beta-galactosidase catalyzed conversion of the X-gal substrate. We conclude that EGFP allows sensitive and convenient detection of gene transfer in mammalian cells.
JournalBiochem Biophys Res Commun. 227(3): 707-11.
SummaryThis paper is not about recoding a gene to improve expression. Rather it is about comparing the sensitivity of two reporter genes in mammalian cells. β-gal has an advantage in sensitivity over wild-type GFP, but the authors are able to show with the appropriate modifications to the GFP gene, GFP can be made into the more sensitive of the two reporter genes. Namely the pEGFP-C1 plasmid constructed by Clontech was used. The authors then transfected four different cell lines (CHO-K1; COS-1; HeLa; BHK-21). Transfection efficiencies were significantly and consistently higher than that of β-gal in all cell lines except BHK-21, where the efficiencies were the similar. The authors also mention some advantages GFP has over β-gal. These include that GFP’s ability to produce stable fluorescence and that GFP’s presence can be monitored non-invasively with techniques like fluorescence microscopy, flow cytometry and macroscopic imaging.
CommentsFor more information on the design and recoding of EGFP, refer to information submitted on Yang 1996 in RGDB. Corresponding author fax: (415)354-0776.
Discussion
PubMed ID8885998
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site